BLASTN 1.5.4-Paracel [2003-06-05] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= SCAFFOLD145634_10395_Chr1 (501 letters) Database: Btau20060815-freeze linearScaffolds ChrKnown-split and ChrUnKnown 40,107 sequences; 3,173,216,901 total letters Searching...................................................done Score E Sequences producing significant alignments: (bits) Value gb|CM000177| Bos taurus chromosome 1-FRAG[2610000,2709999] 928 0.0 gb|CM000182| Bos taurus chromosome 6-FRAG[91530000,91629999] 202 1e-49 gb|CM000187| Bos taurus chromosome 11-FRAG[1710000,1809999] 198 2e-48 gb|CM000206| Bos taurus chromosome X-FRAG[990000,1089999] 196 9e-48 gb|CM000182| Bos taurus chromosome 6-FRAG[42390000,42489999] 196 9e-48 gb|CM000180| Bos taurus chromosome 4-FRAG[19260000,19359999] 196 9e-48 gb|CM000177| Bos taurus chromosome 1-FRAG[99180000,99279999] 194 4e-47 gb|CM000177| Bos taurus chromosome 1-FRAG[99090000,99189999] 194 4e-47 gb|CM000178| Bos taurus chromosome 2-FRAG[67140000,67239999] 192 1e-46 gb|CM000202| Bos taurus chromosome 26-FRAG[31050000,31149999] 192 1e-46 gb|CM000202| Bos taurus chromosome 26-FRAG[30960000,31059999] 192 1e-46 gb|CM000195| Bos taurus chromosome 19-FRAG[29160000,29259999] 190 6e-46 gb|CM000195| Bos taurus chromosome 19-FRAG[14130000,14229999] 190 6e-46 gb|CM000187| Bos taurus chromosome 11-FRAG[46350000,46449999] 190 6e-46 gb|CM000177| Bos taurus chromosome 1-FRAG[135810000,135909999] 188 2e-45 gb|CM000177| Bos taurus chromosome 1-FRAG[99720000,99819999] 188 2e-45 gb|CM000194| Bos taurus chromosome 18-FRAG[27630000,27729999] 188 2e-45 gb|CM000188| Bos taurus chromosome 12-FRAG[12330000,12429999] 188 2e-45 gi|112125186|gb|AAFC03053128.1| Bos taurus Ctg34.CH240-382O18, w... 186 9e-45 gb|CM000185| Bos taurus chromosome 9-FRAG[23220000,23319999] 186 9e-45 gb|CM000179| Bos taurus chromosome 3-FRAG[88110000,88209999] 186 9e-45 gb|CM000202| Bos taurus chromosome 26-FRAG[32040000,32139999] 186 9e-45 gb|CM000199| Bos taurus chromosome 23-FRAG[14220000,14319999] 186 9e-45 gb|CH975134| Bos taurus ChrUn.003.940 genomic scaffold 184 3e-44 gb|CM000185| Bos taurus chromosome 9-FRAG[15390000,15489999] 184 3e-44 gb|CM000179| Bos taurus chromosome 3-FRAG[91530000,91629999] 184 3e-44 gb|CM000178| Bos taurus chromosome 2-FRAG[68310000,68409999] 184 3e-44 gb|CM000205| Bos taurus chromosome 29-FRAG[25830000,25929999] 184 3e-44 gb|CM000205| Bos taurus chromosome 29-FRAG[25740000,25839999] 184 3e-44 gb|CM000201| Bos taurus chromosome 25-FRAG[9000000,9099999] 184 3e-44 gb|CM000201| Bos taurus chromosome 25-FRAG[8910000,9009999] 184 3e-44 gb|CM000190| Bos taurus chromosome 14-FRAG[9450000,9549999] 184 3e-44 gb|CM000189| Bos taurus chromosome 13-FRAG[23670000,23769999] 184 3e-44 gb|CM000188| Bos taurus chromosome 12-FRAG[11250000,11349999] 184 3e-44 gb|CM000186| Bos taurus chromosome 10-FRAG[58320000,58419999] 184 3e-44 gb|CM000206| Bos taurus chromosome X-FRAG[42930000,43029999] 182 1e-43 gb|CM000184| Bos taurus chromosome 8-FRAG[93870000,93969999] 182 1e-43 gb|CM000183| Bos taurus chromosome 7-FRAG[60840000,60939999] 182 1e-43 gb|CM000183| Bos taurus chromosome 7-FRAG[58230000,58329999] 182 1e-43 gb|CM000202| Bos taurus chromosome 26-FRAG[34380000,34479999] 182 1e-43 gb|CM000201| Bos taurus chromosome 25-FRAG[16830000,16929999] 182 1e-43 gb|CM000200| Bos taurus chromosome 24-FRAG[3240000,3339999] 182 1e-43 gb|CM000195| Bos taurus chromosome 19-FRAG[55890000,55989999] 182 1e-43 gb|CM000193| Bos taurus chromosome 17-FRAG[9180000,9279999] 182 1e-43 gb|CM000185| Bos taurus chromosome 9-FRAG[51390000,51489999] 180 5e-43 gb|CM000185| Bos taurus chromosome 9-FRAG[35460000,35559999] 180 5e-43 gb|CM000183| Bos taurus chromosome 7-FRAG[57060000,57159999] 180 5e-43 gb|CM000181| Bos taurus chromosome 5-FRAG[42750000,42849999] 180 5e-43 gb|CM000181| Bos taurus chromosome 5-FRAG[42660000,42759999] 180 5e-43 gb|CM000180| Bos taurus chromosome 4-FRAG[96750000,96849999] 180 5e-43 gb|CM000180| Bos taurus chromosome 4-FRAG[14580000,14679999] 180 5e-43 gb|CM000178| Bos taurus chromosome 2-FRAG[62910000,63009999] 180 5e-43 gb|CM000195| Bos taurus chromosome 19-FRAG[8280000,8379999] 180 5e-43 gb|CM000190| Bos taurus chromosome 14-FRAG[60030000,60129999] 180 5e-43 gb|CM000189| Bos taurus chromosome 13-FRAG[56250000,56349999] 180 5e-43 gb|CM000187| Bos taurus chromosome 11-FRAG[15120000,15219999] 180 5e-43 gb|CM000185| Bos taurus chromosome 9-FRAG[18360000,18459999] 178 2e-42 gb|CM000183| Bos taurus chromosome 7-FRAG[58950000,59049999] 178 2e-42 gb|CM000180| Bos taurus chromosome 4-FRAG[90720000,90819999] 178 2e-42 gb|CM000180| Bos taurus chromosome 4-FRAG[64440000,64539999] 178 2e-42 gb|CM000204| Bos taurus chromosome 28-FRAG[3780000,3879999] 178 2e-42 gb|CM000202| Bos taurus chromosome 26-FRAG[27810000,27909999] 178 2e-42 gb|CM000199| Bos taurus chromosome 23-FRAG[36180000,36279999] 178 2e-42 gb|CM000188| Bos taurus chromosome 12-FRAG[5040000,5139999] 178 2e-42 gb|CM000187| Bos taurus chromosome 11-FRAG[62640000,62739999] 178 2e-42 gi|112110930|gb|AAFC03067381.1| Bos taurus Ctg68.CH240-451L4, wh... 176 8e-42 gb|CH974535| Bos taurus ChrUn.003.332 genomic scaffold 176 8e-42 gb|CM000206| Bos taurus chromosome X-FRAG[69210000,69309999] 176 8e-42 gb|CM000206| Bos taurus chromosome X-FRAG[58410000,58509999] 176 8e-42 gb|CM000184| Bos taurus chromosome 8-FRAG[88920000,89019999] 176 8e-42 gb|CM000180| Bos taurus chromosome 4-FRAG[51120000,51219999] 176 8e-42 gb|CM000179| Bos taurus chromosome 3-FRAG[28620000,28719999] 176 8e-42 gb|CM000179| Bos taurus chromosome 3-FRAG[18900000,18999999] 176 8e-42 gb|CM000179| Bos taurus chromosome 3-FRAG[18810000,18909999] 176 8e-42 gb|CM000205| Bos taurus chromosome 29-FRAG[12780000,12879999] 176 8e-42 gb|CM000198| Bos taurus chromosome 22-FRAG[51030000,51129999] 176 8e-42 gb|CM000196| Bos taurus chromosome 20-FRAG[51660000,51759999] 176 8e-42 gb|CM000177| Bos taurus chromosome 1-FRAG[140220000,140319999] 176 8e-42 gb|CM000177| Bos taurus chromosome 1-FRAG[120330000,120429999] 176 8e-42 gb|CM000195| Bos taurus chromosome 19-FRAG[54990000,55089999] 176 8e-42 gb|CM000194| Bos taurus chromosome 18-FRAG[7200000,7299999] 176 8e-42 gb|CM000193| Bos taurus chromosome 17-FRAG[47790000,47889999] 176 8e-42 gb|CM000186| Bos taurus chromosome 10-FRAG[10800000,10899999] 176 8e-42 gi|112143062|gb|AAFC03035597.1| Bos taurus Ctg27.CH240-287L15, w... 174 3e-41 gb|CH975180| Bos taurus ChrUn.003.988 genomic scaffold 174 3e-41 gb|CH974795| Bos taurus ChrUn.003.592 genomic scaffold 174 3e-41 gb|CH974257| Bos taurus ChrUn.003.54 genomic scaffold 174 3e-41 gb|CH975661| Bos taurus ChrUn.003.1489 genomic scaffold 174 3e-41 gb|CH974215| Bos taurus ChrUn.003.12 genomic scaffold 174 3e-41 gb|CM000206| Bos taurus chromosome X-FRAG[93150000,93249999] 174 3e-41 gb|CM000206| Bos taurus chromosome X-FRAG[29700000,29799999] 174 3e-41 gb|CM000184| Bos taurus chromosome 8-FRAG[60750000,60849999] 174 3e-41 gb|CM000181| Bos taurus chromosome 5-FRAG[116910000,117009999] 174 3e-41 gb|CM000181| Bos taurus chromosome 5-FRAG[102690000,102789999] 174 3e-41 gb|CM000179| Bos taurus chromosome 3-FRAG[109080000,109179999] 174 3e-41 gb|CM000179| Bos taurus chromosome 3-FRAG[108990000,109089999] 174 3e-41 gb|CM000179| Bos taurus chromosome 3-FRAG[47160000,47259999] 174 3e-41 gb|CM000205| Bos taurus chromosome 29-FRAG[10710000,10809999] 174 3e-41 gb|CM000204| Bos taurus chromosome 28-FRAG[31770000,31869999] 174 3e-41 gb|CM000201| Bos taurus chromosome 25-FRAG[36810000,36909999] 174 3e-41 gb|CM000201| Bos taurus chromosome 25-FRAG[12150000,12249999] 174 3e-41 gb|CM000200| Bos taurus chromosome 24-FRAG[51030000,51129999] 174 3e-41 gb|CM000198| Bos taurus chromosome 22-FRAG[7110000,7209999] 174 3e-41 gb|CM000196| Bos taurus chromosome 20-FRAG[24750000,24849999] 174 3e-41 gb|CM000177| Bos taurus chromosome 1-FRAG[101880000,101979999] 174 3e-41 gb|CM000195| Bos taurus chromosome 19-FRAG[37260000,37359999] 174 3e-41 gb|CM000195| Bos taurus chromosome 19-FRAG[8460000,8559999] 174 3e-41 gb|CM000194| Bos taurus chromosome 18-FRAG[15840000,15939999] 174 3e-41 gb|CM000192| Bos taurus chromosome 16-FRAG[37800000,37899999] 174 3e-41 gb|CM000191| Bos taurus chromosome 15-FRAG[58860000,58959999] 174 3e-41 gb|CM000190| Bos taurus chromosome 14-FRAG[38430000,38529999] 174 3e-41 gb|CM000188| Bos taurus chromosome 12-FRAG[76410000,76509999] 174 3e-41 gb|CM000187| Bos taurus chromosome 11-FRAG[99630000,99729999] 174 3e-41 gb|CM000186| Bos taurus chromosome 10-FRAG[73710000,73809999] 174 3e-41 gb|CH978049| Bos taurus ChrUn.003.4172 genomic scaffold 172 1e-40 gb|CH976777| Bos taurus ChrUn.003.2694 genomic scaffold 172 1e-40 gb|CH976466| Bos taurus ChrUn.003.2357 genomic scaffold 172 1e-40 gb|CH974362| Bos taurus ChrUn.003.159 genomic scaffold 172 1e-40 gb|CH975383| Bos taurus ChrUn.003.1198 genomic scaffold 172 1e-40 gb|CM000206| Bos taurus chromosome X-FRAG[270000,369999] 172 1e-40 gb|CM000185| Bos taurus chromosome 9-FRAG[68130000,68229999] 172 1e-40 gb|CM000185| Bos taurus chromosome 9-FRAG[59850000,59949999] 172 1e-40 gb|CM000183| Bos taurus chromosome 7-FRAG[93240000,93339999] 172 1e-40 gb|CM000183| Bos taurus chromosome 7-FRAG[47070000,47169999] 172 1e-40 gb|CM000182| Bos taurus chromosome 6-FRAG[104130000,104229999] 172 1e-40 gb|CM000180| Bos taurus chromosome 4-FRAG[84060000,84159999] 172 1e-40 gb|CM000180| Bos taurus chromosome 4-FRAG[83160000,83259999] 172 1e-40 gb|CM000179| Bos taurus chromosome 3-FRAG[105480000,105579999] 172 1e-40 gb|CM000179| Bos taurus chromosome 3-FRAG[105390000,105489999] 172 1e-40 gb|CM000179| Bos taurus chromosome 3-FRAG[33030000,33129999] 172 1e-40 gb|CM000179| Bos taurus chromosome 3-FRAG[19350000,19449999] 172 1e-40 gb|CM000205| Bos taurus chromosome 29-FRAG[8100000,8199999] 172 1e-40 gb|CM000203| Bos taurus chromosome 27-FRAG[17100000,17199999] 172 1e-40 gb|CM000201| Bos taurus chromosome 25-FRAG[31050000,31149999] 172 1e-40 gb|CM000199| Bos taurus chromosome 23-FRAG[24300000,24399999] 172 1e-40 gb|CM000199| Bos taurus chromosome 23-FRAG[24210000,24309999] 172 1e-40 gb|CM000199| Bos taurus chromosome 23-FRAG[23130000,23229999] 172 1e-40 gb|CM000198| Bos taurus chromosome 22-FRAG[47790000,47889999] 172 1e-40 gb|CM000197| Bos taurus chromosome 21-FRAG[31500000,31599999] 172 1e-40 gb|CM000197| Bos taurus chromosome 21-FRAG[31410000,31509999] 172 1e-40 gb|CM000194| Bos taurus chromosome 18-FRAG[51300000,51399999] 172 1e-40 gb|CM000190| Bos taurus chromosome 14-FRAG[15930000,16029999] 172 1e-40 gb|CM000189| Bos taurus chromosome 13-FRAG[77940000,78039999] 172 1e-40 gb|CM000189| Bos taurus chromosome 13-FRAG[77850000,77949999] 172 1e-40 gb|CM000188| Bos taurus chromosome 12-FRAG[45630000,45729999] 172 1e-40 gb|CM000187| Bos taurus chromosome 11-FRAG[10170000,10269999] 172 1e-40 gb|CM000186| Bos taurus chromosome 10-FRAG[13680000,13779999] 172 1e-40 gb|CH974825| Bos taurus ChrUn.003.622 genomic scaffold 170 5e-40 gb|CH974817| Bos taurus ChrUn.003.614 genomic scaffold 170 5e-40 gb|CH974794| Bos taurus ChrUn.003.591 genomic scaffold 170 5e-40 gb|CH974242| Bos taurus ChrUn.003.39 genomic scaffold 170 5e-40 gb|CH976260| Bos taurus ChrUn.003.2133 genomic scaffold 170 5e-40 gb|CM000184| Bos taurus chromosome 8-FRAG[39150000,39249999] 170 5e-40 gb|CM000183| Bos taurus chromosome 7-FRAG[83160000,83259999] 170 5e-40 gb|CM000183| Bos taurus chromosome 7-FRAG[69300000,69399999] 170 5e-40 gb|CM000182| Bos taurus chromosome 6-FRAG[53370000,53469999] 170 5e-40 gb|CM000182| Bos taurus chromosome 6-FRAG[18450000,18549999] 170 5e-40 gb|CM000181| Bos taurus chromosome 5-FRAG[108270000,108369999] 170 5e-40 gb|CM000181| Bos taurus chromosome 5-FRAG[23760000,23859999] 170 5e-40 gb|CM000181| Bos taurus chromosome 5-FRAG[22950000,23049999] 170 5e-40 gb|CM000180| Bos taurus chromosome 4-FRAG[16110000,16209999] 170 5e-40 gb|CM000178| Bos taurus chromosome 2-FRAG[117000000,117099999] 170 5e-40 gb|CM000178| Bos taurus chromosome 2-FRAG[20430000,20529999] 170 5e-40 gb|CM000205| Bos taurus chromosome 29-FRAG[27540000,27639999] 170 5e-40 gb|CM000203| Bos taurus chromosome 27-FRAG[28350000,28449999] 170 5e-40 gb|CM000203| Bos taurus chromosome 27-FRAG[15840000,15939999] 170 5e-40 gb|CM000199| Bos taurus chromosome 23-FRAG[40140000,40239999] 170 5e-40 gb|CM000198| Bos taurus chromosome 22-FRAG[6480000,6579999] 170 5e-40 gb|CM000177| Bos taurus chromosome 1-FRAG[80550000,80649999] 170 5e-40 gb|CM000177| Bos taurus chromosome 1-FRAG[57870000,57969999] 170 5e-40 gb|CM000177| Bos taurus chromosome 1-FRAG[53460000,53559999] 170 5e-40 gb|CM000195| Bos taurus chromosome 19-FRAG[57060000,57159999] 170 5e-40 gb|CM000195| Bos taurus chromosome 19-FRAG[17280000,17379999] 170 5e-40 gb|CM000193| Bos taurus chromosome 17-FRAG[47430000,47529999] 170 5e-40 gb|CM000193| Bos taurus chromosome 17-FRAG[46350000,46449999] 170 5e-40 gb|CM000193| Bos taurus chromosome 17-FRAG[46260000,46359999] 170 5e-40 gb|CM000193| Bos taurus chromosome 17-FRAG[34830000,34929999] 170 5e-40 gb|CM000193| Bos taurus chromosome 17-FRAG[9900000,9999999] 170 5e-40 gb|CM000193| Bos taurus chromosome 17-FRAG[9810000,9909999] 170 5e-40 gb|CM000192| Bos taurus chromosome 16-FRAG[66150000,66249999] 170 5e-40 gb|CM000192| Bos taurus chromosome 16-FRAG[24840000,24939999] 170 5e-40 gb|CM000191| Bos taurus chromosome 15-FRAG[41850000,41949999] 170 5e-40 gb|CM000191| Bos taurus chromosome 15-FRAG[41760000,41859999] 170 5e-40 gb|CM000188| Bos taurus chromosome 12-FRAG[22140000,22239999] 170 5e-40 gb|CM000188| Bos taurus chromosome 12-FRAG[22050000,22149999] 170 5e-40 gb|CM000188| Bos taurus chromosome 12-FRAG[10350000,10449999] 170 5e-40 gb|CM000186| Bos taurus chromosome 10-FRAG[78480000,78579999] 170 5e-40 gi|112113022|gb|AAFC03065289.1| Bos taurus Ctg36.CH240-442K13, w... 168 2e-39 gi|112113464|gb|AAFC03064850.1| Bos taurus Ctg39.CH240-440D10, w... 168 2e-39 gb|CH974270| Bos taurus ChrUn.003.67 genomic scaffold 168 2e-39 gb|CH974207| Bos taurus ChrUn.003.4 genomic scaffold 168 2e-39 gb|CH974483| Bos taurus ChrUn.003.280 genomic scaffold 168 2e-39 gb|CH974343| Bos taurus ChrUn.003.140 genomic scaffold 168 2e-39 gb|CH974309| Bos taurus ChrUn.003.106 genomic scaffold 168 2e-39 gb|CM000206| Bos taurus chromosome X-FRAG[58320000,58419999] 168 2e-39 gb|CM000206| Bos taurus chromosome X-FRAG[10530000,10629999] 168 2e-39 gb|CM000206| Bos taurus chromosome X-FRAG[10440000,10539999] 168 2e-39 gb|CM000185| Bos taurus chromosome 9-FRAG[76680000,76779999] 168 2e-39 gb|CM000185| Bos taurus chromosome 9-FRAG[73080000,73179999] 168 2e-39 gb|CM000185| Bos taurus chromosome 9-FRAG[32040000,32139999] 168 2e-39 gb|CM000184| Bos taurus chromosome 8-FRAG[98370000,98469999] 168 2e-39 gb|CM000184| Bos taurus chromosome 8-FRAG[91800000,91899999] 168 2e-39 gb|CM000184| Bos taurus chromosome 8-FRAG[18540000,18639999] 168 2e-39 gb|CM000182| Bos taurus chromosome 6-FRAG[97110000,97209999] 168 2e-39 gb|CM000182| Bos taurus chromosome 6-FRAG[38340000,38439999] 168 2e-39 gb|CM000182| Bos taurus chromosome 6-FRAG[38250000,38349999] 168 2e-39 gb|CM000181| Bos taurus chromosome 5-FRAG[113580000,113679999] 168 2e-39 gb|CM000181| Bos taurus chromosome 5-FRAG[72630000,72729999] 168 2e-39 gb|CM000181| Bos taurus chromosome 5-FRAG[67950000,68049999] 168 2e-39 gb|CM000180| Bos taurus chromosome 4-FRAG[72000000,72099999] 168 2e-39 gb|CM000180| Bos taurus chromosome 4-FRAG[10980000,11079999] 168 2e-39 gb|CM000180| Bos taurus chromosome 4-FRAG[10890000,10989999] 168 2e-39 gb|CM000180| Bos taurus chromosome 4-FRAG[9450000,9549999] 168 2e-39 gb|CM000179| Bos taurus chromosome 3-FRAG[105120000,105219999] 168 2e-39 gb|CM000179| Bos taurus chromosome 3-FRAG[62640000,62739999] 168 2e-39 gb|CM000179| Bos taurus chromosome 3-FRAG[45900000,45999999] 168 2e-39 gb|CM000179| Bos taurus chromosome 3-FRAG[22230000,22329999] 168 2e-39 gb|CM000178| Bos taurus chromosome 2-FRAG[88290000,88389999] 168 2e-39 gb|CM000178| Bos taurus chromosome 2-FRAG[56610000,56709999] 168 2e-39 gb|CM000178| Bos taurus chromosome 2-FRAG[4050000,4149999] 168 2e-39 gb|CM000205| Bos taurus chromosome 29-FRAG[31230000,31329999] 168 2e-39 gb|CM000203| Bos taurus chromosome 27-FRAG[30060000,30159999] 168 2e-39 gb|CM000203| Bos taurus chromosome 27-FRAG[17640000,17739999] 168 2e-39 gb|CM000203| Bos taurus chromosome 27-FRAG[4680000,4779999] 168 2e-39 gb|CM000202| Bos taurus chromosome 26-FRAG[10350000,10449999] 168 2e-39 gb|CM000200| Bos taurus chromosome 24-FRAG[49680000,49779999] 168 2e-39 gb|CM000196| Bos taurus chromosome 20-FRAG[18090000,18189999] 168 2e-39 gb|CM000177| Bos taurus chromosome 1-FRAG[121770000,121869999] 168 2e-39 gb|CM000177| Bos taurus chromosome 1-FRAG[96840000,96939999] 168 2e-39 gb|CM000177| Bos taurus chromosome 1-FRAG[48240000,48339999] 168 2e-39 gb|CM000195| Bos taurus chromosome 19-FRAG[19440000,19539999] 168 2e-39 gb|CM000194| Bos taurus chromosome 18-FRAG[19350000,19449999] 168 2e-39 gb|CM000191| Bos taurus chromosome 15-FRAG[31320000,31419999] 168 2e-39 gb|CM000190| Bos taurus chromosome 14-FRAG[62730000,62829999] 168 2e-39 gb|CM000189| Bos taurus chromosome 13-FRAG[79560000,79659999] 168 2e-39 gb|CM000189| Bos taurus chromosome 13-FRAG[75420000,75519999] 168 2e-39 gb|CM000188| Bos taurus chromosome 12-FRAG[67860000,67959999] 168 2e-39 gb|CM000188| Bos taurus chromosome 12-FRAG[67770000,67869999] 168 2e-39 gb|CM000188| Bos taurus chromosome 12-FRAG[61290000,61389999] 168 2e-39 gb|CM000188| Bos taurus chromosome 12-FRAG[28710000,28809999] 168 2e-39 gb|CM000187| Bos taurus chromosome 11-FRAG[89370000,89469999] 168 2e-39 gb|CM000187| Bos taurus chromosome 11-FRAG[43830000,43929999] 168 2e-39 gb|CM000187| Bos taurus chromosome 11-FRAG[14580000,14679999] 168 2e-39 gb|CM000187| Bos taurus chromosome 11-FRAG[10350000,10449999] 168 2e-39 gb|CM000186| Bos taurus chromosome 10-FRAG[16110000,16209999] 168 2e-39 gb|CH974290| Bos taurus ChrUn.003.87 genomic scaffold 167 8e-39 gb|CH974517| Bos taurus ChrUn.003.314 genomic scaffold 167 8e-39 gb|CH974487| Bos taurus ChrUn.003.284 genomic scaffold 167 8e-39 gb|CH974450| Bos taurus ChrUn.003.247 genomic scaffold 167 8e-39 gb|CH974373| Bos taurus ChrUn.003.170 genomic scaffold 167 8e-39 gb|CH974364| Bos taurus ChrUn.003.161 genomic scaffold 167 8e-39 gb|CH974319| Bos taurus ChrUn.003.116 genomic scaffold 167 8e-39 gb|CH975310| Bos taurus ChrUn.003.1123 genomic scaffold 167 8e-39 gb|CH974307| Bos taurus ChrUn.003.104 genomic scaffold 167 8e-39 gb|CH975202| Bos taurus ChrUn.003.1011 genomic scaffold 167 8e-39 gb|CM000206| Bos taurus chromosome X-FRAG[95490000,95589999] 167 8e-39 gb|CM000206| Bos taurus chromosome X-FRAG[95400000,95499999] 167 8e-39 gb|CM000206| Bos taurus chromosome X-FRAG[75150000,75249999] 167 8e-39 gb|CM000206| Bos taurus chromosome X-FRAG[70650000,70749999] 167 8e-39 gb|CM000206| Bos taurus chromosome X-FRAG[43290000,43389999] 167 8e-39 gb|CM000206| Bos taurus chromosome X-FRAG[11340000,11439999] 167 8e-39 gb|CM000206| Bos taurus chromosome X-FRAG[11250000,11349999] 167 8e-39 gb|CM000184| Bos taurus chromosome 8-FRAG[97740000,97839999] 167 8e-39 gb|CM000184| Bos taurus chromosome 8-FRAG[94680000,94779999] 167 8e-39 gb|CM000184| Bos taurus chromosome 8-FRAG[84690000,84789999] 167 8e-39 gb|CM000184| Bos taurus chromosome 8-FRAG[40770000,40869999] 167 8e-39 gb|CM000184| Bos taurus chromosome 8-FRAG[29880000,29979999] 167 8e-39 gb|CM000183| Bos taurus chromosome 7-FRAG[9450000,9549999] 167 8e-39 gb|CM000183| Bos taurus chromosome 7-FRAG[5670000,5769999] 167 8e-39 gb|CM000183| Bos taurus chromosome 7-FRAG[2250000,2349999] 167 8e-39 gb|CM000182| Bos taurus chromosome 6-FRAG[94320000,94419999] 167 8e-39 gb|CM000182| Bos taurus chromosome 6-FRAG[67230000,67329999] 167 8e-39 gb|CM000181| Bos taurus chromosome 5-FRAG[108450000,108549999] 167 8e-39 gb|CM000181| Bos taurus chromosome 5-FRAG[108000000,108099999] 167 8e-39 gb|CM000181| Bos taurus chromosome 5-FRAG[95940000,96039999] 167 8e-39 gb|CM000181| Bos taurus chromosome 5-FRAG[54900000,54999999] 167 8e-39 gb|CM000181| Bos taurus chromosome 5-FRAG[28170000,28269999] 167 8e-39 gb|CM000180| Bos taurus chromosome 4-FRAG[102330000,102429999] 167 8e-39 gb|CM000179| Bos taurus chromosome 3-FRAG[113310000,113409999] 167 8e-39 gb|CM000179| Bos taurus chromosome 3-FRAG[112500000,112599999] 167 8e-39 gb|CM000178| Bos taurus chromosome 2-FRAG[76500000,76599999] 167 8e-39 gb|CM000178| Bos taurus chromosome 2-FRAG[63630000,63729999] 167 8e-39 gb|CM000205| Bos taurus chromosome 29-FRAG[36630000,36729999] 167 8e-39 gb|CM000205| Bos taurus chromosome 29-FRAG[32580000,32679999] 167 8e-39 gb|CM000204| Bos taurus chromosome 28-FRAG[30600000,30699999] 167 8e-39 gb|CM000204| Bos taurus chromosome 28-FRAG[11250000,11349999] 167 8e-39 gb|CM000204| Bos taurus chromosome 28-FRAG[2160000,2259999] 167 8e-39 gb|CM000203| Bos taurus chromosome 27-FRAG[39960000,40059999] 167 8e-39 gb|CM000203| Bos taurus chromosome 27-FRAG[1620000,1719999] 167 8e-39 gb|CM000202| Bos taurus chromosome 26-FRAG[30420000,30519999] 167 8e-39 gb|CM000202| Bos taurus chromosome 26-FRAG[30330000,30429999] 167 8e-39 gb|CM000201| Bos taurus chromosome 25-FRAG[30420000,30519999] 167 8e-39 gb|CM000201| Bos taurus chromosome 25-FRAG[27180000,27279999] 167 8e-39 gb|CM000201| Bos taurus chromosome 25-FRAG[17190000,17289999] 167 8e-39 gb|CM000201| Bos taurus chromosome 25-FRAG[17010000,17109999] 167 8e-39 gb|CM000201| Bos taurus chromosome 25-FRAG[11970000,12069999] 167 8e-39 gb|CM000200| Bos taurus chromosome 24-FRAG[56520000,56619999] 167 8e-39 gb|CM000199| Bos taurus chromosome 23-FRAG[47880000,47979999] 167 8e-39 gb|CM000199| Bos taurus chromosome 23-FRAG[47700000,47799999] 167 8e-39 gb|CM000199| Bos taurus chromosome 23-FRAG[21330000,21429999] 167 8e-39 gb|CM000197| Bos taurus chromosome 21-FRAG[44460000,44559999] 167 8e-39 gb|CM000197| Bos taurus chromosome 21-FRAG[23130000,23229999] 167 8e-39 gb|CM000197| Bos taurus chromosome 21-FRAG[19620000,19719999] 167 8e-39 gb|CM000197| Bos taurus chromosome 21-FRAG[1080000,1179999] 167 8e-39 gb|CM000197| Bos taurus chromosome 21-FRAG[990000,1089999] 167 8e-39 gb|CM000196| Bos taurus chromosome 20-FRAG[63360000,63459999] 167 8e-39 gb|CM000196| Bos taurus chromosome 20-FRAG[55800000,55899999] 167 8e-39 gb|CM000196| Bos taurus chromosome 20-FRAG[29970000,30069999] 167 8e-39 gb|CM000177| Bos taurus chromosome 1-FRAG[128070000,128169999] 167 8e-39 gb|CM000195| Bos taurus chromosome 19-FRAG[17190000,17289999] 167 8e-39 gb|CM000195| Bos taurus chromosome 19-FRAG[7290000,7389999] 167 8e-39 gb|CM000194| Bos taurus chromosome 18-FRAG[16020000,16119999] 167 8e-39 gb|CM000194| Bos taurus chromosome 18-FRAG[2970000,3069999] 167 8e-39 gb|CM000191| Bos taurus chromosome 15-FRAG[63540000,63639999] 167 8e-39 gb|CM000190| Bos taurus chromosome 14-FRAG[58050000,58149999] 167 8e-39 gb|CM000190| Bos taurus chromosome 14-FRAG[46980000,47079999] 167 8e-39 gb|CM000190| Bos taurus chromosome 14-FRAG[46080000,46179999] 167 8e-39 gb|CM000189| Bos taurus chromosome 13-FRAG[75600000,75699999] 167 8e-39 gb|CM000189| Bos taurus chromosome 13-FRAG[67230000,67329999] 167 8e-39 gb|CM000189| Bos taurus chromosome 13-FRAG[64350000,64449999] 167 8e-39 gb|CM000189| Bos taurus chromosome 13-FRAG[39420000,39519999] 167 8e-39 gb|CM000187| Bos taurus chromosome 11-FRAG[71820000,71919999] 167 8e-39 gb|CM000187| Bos taurus chromosome 11-FRAG[22140000,22239999] 167 8e-39 gb|CM000187| Bos taurus chromosome 11-FRAG[20880000,20979999] 167 8e-39 gb|CM000187| Bos taurus chromosome 11-FRAG[20790000,20889999] 167 8e-39 gb|CM000186| Bos taurus chromosome 10-FRAG[78300000,78399999] 167 8e-39 gb|CM000186| Bos taurus chromosome 10-FRAG[59580000,59679999] 167 8e-39 gb|CM000186| Bos taurus chromosome 10-FRAG[24210000,24309999] 167 8e-39 gb|CH979780| Bos taurus ChrUn.003.6182 genomic scaffold 165 3e-38 gb|CH974260| Bos taurus ChrUn.003.57 genomic scaffold 165 3e-38 gb|CH974691| Bos taurus ChrUn.003.488 genomic scaffold 165 3e-38 gb|CH978574| Bos taurus ChrUn.003.4770 genomic scaffold 165 3e-38 gb|CH978295| Bos taurus ChrUn.003.4454 genomic scaffold 165 3e-38 gb|CH977444| Bos taurus ChrUn.003.3463 genomic scaffold 165 3e-38 gb|CH974422| Bos taurus ChrUn.003.219 genomic scaffold 165 3e-38 gb|CM000206| Bos taurus chromosome X-FRAG[98190000,98289999] 165 3e-38 gb|CM000206| Bos taurus chromosome X-FRAG[82710000,82809999] 165 3e-38 gb|CM000206| Bos taurus chromosome X-FRAG[69930000,70029999] 165 3e-38 gb|CM000206| Bos taurus chromosome X-FRAG[450000,549999] 165 3e-38 gb|CM000185| Bos taurus chromosome 9-FRAG[69300000,69399999] 165 3e-38 gb|CM000185| Bos taurus chromosome 9-FRAG[62190000,62289999] 165 3e-38 gb|CM000185| Bos taurus chromosome 9-FRAG[30240000,30339999] 165 3e-38 gb|CM000184| Bos taurus chromosome 8-FRAG[86130000,86229999] 165 3e-38 gb|CM000184| Bos taurus chromosome 8-FRAG[10080000,10179999] 165 3e-38 gb|CM000183| Bos taurus chromosome 7-FRAG[91170000,91269999] 165 3e-38 gb|CM000183| Bos taurus chromosome 7-FRAG[28440000,28539999] 165 3e-38 gb|CM000182| Bos taurus chromosome 6-FRAG[108090000,108189999] 165 3e-38 gb|CM000182| Bos taurus chromosome 6-FRAG[90000000,90099999] 165 3e-38 gb|CM000182| Bos taurus chromosome 6-FRAG[89370000,89469999] 165 3e-38 gb|CM000182| Bos taurus chromosome 6-FRAG[66240000,66339999] 165 3e-38 gb|CM000182| Bos taurus chromosome 6-FRAG[66150000,66249999] 165 3e-38 gb|CM000182| Bos taurus chromosome 6-FRAG[63900000,63999999] 165 3e-38 gb|CM000182| Bos taurus chromosome 6-FRAG[61470000,61569999] 165 3e-38 gb|CM000181| Bos taurus chromosome 5-FRAG[92340000,92439999] 165 3e-38 gb|CM000181| Bos taurus chromosome 5-FRAG[3600000,3699999] 165 3e-38 gb|CM000181| Bos taurus chromosome 5-FRAG[3150000,3249999] 165 3e-38 gb|CM000180| Bos taurus chromosome 4-FRAG[99090000,99189999] 165 3e-38 gb|CM000180| Bos taurus chromosome 4-FRAG[95760000,95859999] 165 3e-38 gb|CM000180| Bos taurus chromosome 4-FRAG[89640000,89739999] 165 3e-38 gb|CM000179| Bos taurus chromosome 3-FRAG[75150000,75249999] 165 3e-38 gb|CM000179| Bos taurus chromosome 3-FRAG[3600000,3699999] 165 3e-38 gb|CM000178| Bos taurus chromosome 2-FRAG[121860000,121959999] 165 3e-38 gb|CM000178| Bos taurus chromosome 2-FRAG[119790000,119889999] 165 3e-38 gb|CM000178| Bos taurus chromosome 2-FRAG[102960000,103059999] 165 3e-38 gb|CM000178| Bos taurus chromosome 2-FRAG[100260000,100359999] 165 3e-38 gb|CM000205| Bos taurus chromosome 29-FRAG[3330000,3429999] 165 3e-38 gb|CM000204| Bos taurus chromosome 28-FRAG[32940000,33039999] 165 3e-38 gb|CM000204| Bos taurus chromosome 28-FRAG[7560000,7659999] 165 3e-38 gb|CM000203| Bos taurus chromosome 27-FRAG[41220000,41319999] 165 3e-38 gb|CM000203| Bos taurus chromosome 27-FRAG[41130000,41229999] 165 3e-38 gb|CM000202| Bos taurus chromosome 26-FRAG[41580000,41679999] 165 3e-38 gb|CM000202| Bos taurus chromosome 26-FRAG[28530000,28629999] 165 3e-38 gb|CM000201| Bos taurus chromosome 25-FRAG[9450000,9549999] 165 3e-38 gb|CM000200| Bos taurus chromosome 24-FRAG[45000000,45099999] 165 3e-38 gb|CM000200| Bos taurus chromosome 24-FRAG[44910000,45009999] 165 3e-38 gb|CM000200| Bos taurus chromosome 24-FRAG[27810000,27909999] 165 3e-38 gb|CM000199| Bos taurus chromosome 23-FRAG[40230000,40329999] 165 3e-38 gb|CM000199| Bos taurus chromosome 23-FRAG[34020000,34119999] 165 3e-38 gb|CM000199| Bos taurus chromosome 23-FRAG[32850000,32949999] 165 3e-38 gb|CM000197| Bos taurus chromosome 21-FRAG[58770000,58869999] 165 3e-38 gb|CM000197| Bos taurus chromosome 21-FRAG[52650000,52749999] 165 3e-38 gb|CM000197| Bos taurus chromosome 21-FRAG[9990000,10089999] 165 3e-38 gb|CM000197| Bos taurus chromosome 21-FRAG[90000,189999] 165 3e-38 gb|CM000196| Bos taurus chromosome 20-FRAG[8550000,8649999] 165 3e-38 gb|CM000177| Bos taurus chromosome 1-FRAG[137340000,137439999] 165 3e-38 gb|CM000177| Bos taurus chromosome 1-FRAG[131490000,131589999] 165 3e-38 gb|CM000177| Bos taurus chromosome 1-FRAG[630000,729999] 165 3e-38 gb|CM000195| Bos taurus chromosome 19-FRAG[62460000,62559999] 165 3e-38 gb|CM000194| Bos taurus chromosome 18-FRAG[17010000,17109999] 165 3e-38 gb|CM000193| Bos taurus chromosome 17-FRAG[63630000,63729999] 165 3e-38 gb|CM000193| Bos taurus chromosome 17-FRAG[9720000,9819999] 165 3e-38 gb|CM000192| Bos taurus chromosome 16-FRAG[50850000,50949999] 165 3e-38 gb|CM000192| Bos taurus chromosome 16-FRAG[18990000,19089999] 165 3e-38 gb|CM000191| Bos taurus chromosome 15-FRAG[63090000,63189999] 165 3e-38 gb|CM000190| Bos taurus chromosome 14-FRAG[63000000,63099999] 165 3e-38 gb|CM000190| Bos taurus chromosome 14-FRAG[17910000,18009999] 165 3e-38 gb|CM000190| Bos taurus chromosome 14-FRAG[14310000,14409999] 165 3e-38 gb|CM000189| Bos taurus chromosome 13-FRAG[77760000,77859999] 165 3e-38 gb|CM000189| Bos taurus chromosome 13-FRAG[76410000,76509999] 165 3e-38 gb|CM000189| Bos taurus chromosome 13-FRAG[74610000,74709999] 165 3e-38 gb|CM000189| Bos taurus chromosome 13-FRAG[34560000,34659999] 165 3e-38 gb|CM000189| Bos taurus chromosome 13-FRAG[34470000,34569999] 165 3e-38 gb|CM000188| Bos taurus chromosome 12-FRAG[68130000,68229999] 165 3e-38 gb|CM000188| Bos taurus chromosome 12-FRAG[57420000,57519999] 165 3e-38 gb|CM000188| Bos taurus chromosome 12-FRAG[47970000,48069999] 165 3e-38 gb|CM000188| Bos taurus chromosome 12-FRAG[29880000,29979999] 165 3e-38 gb|CM000188| Bos taurus chromosome 12-FRAG[11700000,11799999] 165 3e-38 gb|CM000188| Bos taurus chromosome 12-FRAG[11610000,11709999] 165 3e-38 gb|CM000188| Bos taurus chromosome 12-FRAG[990000,1089999] 165 3e-38 gb|CM000187| Bos taurus chromosome 11-FRAG[77850000,77949999] 165 3e-38 gb|CM000187| Bos taurus chromosome 11-FRAG[75420000,75519999] 165 3e-38 gb|CM000187| Bos taurus chromosome 11-FRAG[70470000,70569999] 165 3e-38 gb|CM000187| Bos taurus chromosome 11-FRAG[62730000,62829999] 165 3e-38 gb|CM000187| Bos taurus chromosome 11-FRAG[25200000,25299999] 165 3e-38 gb|CM000186| Bos taurus chromosome 10-FRAG[84510000,84609999] 165 3e-38 gb|CM000186| Bos taurus chromosome 10-FRAG[72090000,72189999] 165 3e-38 gb|CM000186| Bos taurus chromosome 10-FRAG[28350000,28449999] 165 3e-38 gb|CM000186| Bos taurus chromosome 10-FRAG[11970000,12069999] 165 3e-38 gb|CH975034| Bos taurus ChrUn.003.839 genomic scaffold 163 1e-37 gb|CH975016| Bos taurus ChrUn.003.821 genomic scaffold 163 1e-37 gb|CH974277| Bos taurus ChrUn.003.74 genomic scaffold 163 1e-37 gb|CH974836| Bos taurus ChrUn.003.634 genomic scaffold 163 1e-37 gb|CH974697| Bos taurus ChrUn.003.494 genomic scaffold 163 1e-37 gb|CH978680| Bos taurus ChrUn.003.4887 genomic scaffold 163 1e-37 gb|CH974617| Bos taurus ChrUn.003.414 genomic scaffold 163 1e-37 gb|CH974536| Bos taurus ChrUn.003.333 genomic scaffold 163 1e-37 gb|CH976996| Bos taurus ChrUn.003.2939 genomic scaffold 163 1e-37 gb|CH974407| Bos taurus ChrUn.003.204 genomic scaffold 163 1e-37 gb|CH974336| Bos taurus ChrUn.003.133 genomic scaffold 163 1e-37 gb|CH975198| Bos taurus ChrUn.003.1007 genomic scaffold 163 1e-37 gb|CM000206| Bos taurus chromosome X-FRAG[69300000,69399999] 163 1e-37 gb|CM000185| Bos taurus chromosome 9-FRAG[21510000,21609999] 163 1e-37 gb|CM000185| Bos taurus chromosome 9-FRAG[20250000,20349999] 163 1e-37 gb|CM000184| Bos taurus chromosome 8-FRAG[93150000,93249999] 163 1e-37 gb|CM000184| Bos taurus chromosome 8-FRAG[92970000,93069999] 163 1e-37 gb|CM000184| Bos taurus chromosome 8-FRAG[85860000,85959999] 163 1e-37 gb|CM000184| Bos taurus chromosome 8-FRAG[40050000,40149999] 163 1e-37 gb|CM000184| Bos taurus chromosome 8-FRAG[6390000,6489999] 163 1e-37 gb|CM000184| Bos taurus chromosome 8-FRAG[5040000,5139999] 163 1e-37 gb|CM000184| Bos taurus chromosome 8-FRAG[1620000,1719999] 163 1e-37 gb|CM000183| Bos taurus chromosome 7-FRAG[96750000,96849999] 163 1e-37 gb|CM000183| Bos taurus chromosome 7-FRAG[83970000,84069999] 163 1e-37 gb|CM000183| Bos taurus chromosome 7-FRAG[83880000,83979999] 163 1e-37 gb|CM000182| Bos taurus chromosome 6-FRAG[94770000,94869999] 163 1e-37 gb|CM000182| Bos taurus chromosome 6-FRAG[88020000,88119999] 163 1e-37 gb|CM000182| Bos taurus chromosome 6-FRAG[55800000,55899999] 163 1e-37 gb|CM000182| Bos taurus chromosome 6-FRAG[28800000,28899999] 163 1e-37 gb|CM000182| Bos taurus chromosome 6-FRAG[27000000,27099999] 163 1e-37 gb|CM000182| Bos taurus chromosome 6-FRAG[26910000,27009999] 163 1e-37 gb|CM000182| Bos taurus chromosome 6-FRAG[8820000,8919999] 163 1e-37 gb|CM000181| Bos taurus chromosome 5-FRAG[105300000,105399999] 163 1e-37 gb|CM000181| Bos taurus chromosome 5-FRAG[67590000,67689999] 163 1e-37 gb|CM000181| Bos taurus chromosome 5-FRAG[63540000,63639999] 163 1e-37 gb|CM000180| Bos taurus chromosome 4-FRAG[61650000,61749999] 163 1e-37 gb|CM000180| Bos taurus chromosome 4-FRAG[47520000,47619999] 163 1e-37 gb|CM000179| Bos taurus chromosome 3-FRAG[99180000,99279999] 163 1e-37 gb|CM000179| Bos taurus chromosome 3-FRAG[67410000,67509999] 163 1e-37 gb|CM000179| Bos taurus chromosome 3-FRAG[45450000,45549999] 163 1e-37 gb|CM000179| Bos taurus chromosome 3-FRAG[26730000,26829999] 163 1e-37 gb|CM000179| Bos taurus chromosome 3-FRAG[9090000,9189999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[121500000,121599999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[114930000,115029999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[106560000,106659999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[102870000,102969999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[102150000,102249999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[101430000,101529999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[59400000,59499999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[59310000,59409999] 163 1e-37 gb|CM000178| Bos taurus chromosome 2-FRAG[20250000,20349999] 163 1e-37 gb|CM000205| Bos taurus chromosome 29-FRAG[18000000,18099999] 163 1e-37 gb|CM000205| Bos taurus chromosome 29-FRAG[13410000,13509999] 163 1e-37 gb|CM000205| Bos taurus chromosome 29-FRAG[11340000,11439999] 163 1e-37 gb|CM000204| Bos taurus chromosome 28-FRAG[29070000,29169999] 163 1e-37 gb|CM000202| Bos taurus chromosome 26-FRAG[25110000,25209999] 163 1e-37 gb|CM000202| Bos taurus chromosome 26-FRAG[17730000,17829999] 163 1e-37 gb|CM000200| Bos taurus chromosome 24-FRAG[50400000,50499999] 163 1e-37 gb|CM000200| Bos taurus chromosome 24-FRAG[50310000,50409999] 163 1e-37 gb|CM000200| Bos taurus chromosome 24-FRAG[33930000,34029999] 163 1e-37 gb|CM000200| Bos taurus chromosome 24-FRAG[18990000,19089999] 163 1e-37 gb|CM000199| Bos taurus chromosome 23-FRAG[36540000,36639999] 163 1e-37 gb|CM000199| Bos taurus chromosome 23-FRAG[15840000,15939999] 163 1e-37 gb|CM000198| Bos taurus chromosome 22-FRAG[26910000,27009999] 163 1e-37 gb|CM000198| Bos taurus chromosome 22-FRAG[8370000,8469999] 163 1e-37 gb|CM000197| Bos taurus chromosome 21-FRAG[38970000,39069999] 163 1e-37 gb|CM000196| Bos taurus chromosome 20-FRAG[43290000,43389999] 163 1e-37 gb|CM000196| Bos taurus chromosome 20-FRAG[43200000,43299999] 163 1e-37 gb|CM000196| Bos taurus chromosome 20-FRAG[20790000,20889999] 163 1e-37 gb|CM000196| Bos taurus chromosome 20-FRAG[9990000,10089999] 163 1e-37 gb|CM000196| Bos taurus chromosome 20-FRAG[6570000,6669999] 163 1e-37 gb|CM000196| Bos taurus chromosome 20-FRAG[5220000,5319999] 163 1e-37 gb|CM000177| Bos taurus chromosome 1-FRAG[138600000,138699999] 163 1e-37 gb|CM000177| Bos taurus chromosome 1-FRAG[76680000,76779999] 163 1e-37 gb|CM000195| Bos taurus chromosome 19-FRAG[44820000,44919999] 163 1e-37 gb|CM000195| Bos taurus chromosome 19-FRAG[22860000,22959999] 163 1e-37 gb|CM000195| Bos taurus chromosome 19-FRAG[22770000,22869999] 163 1e-37 gb|CM000195| Bos taurus chromosome 19-FRAG[9540000,9639999] 163 1e-37 gb|CM000195| Bos taurus chromosome 19-FRAG[4590000,4689999] 163 1e-37 gb|CM000194| Bos taurus chromosome 18-FRAG[39690000,39789999] 163 1e-37 gb|CM000194| Bos taurus chromosome 18-FRAG[24390000,24489999] 163 1e-37 gb|CM000193| Bos taurus chromosome 17-FRAG[59490000,59589999] 163 1e-37 >gb|CM000177| Bos taurus chromosome 1-FRAG[2610000,2709999] Length = 100000 Score = 928 bits (468), Expect = 0.0 Identities = 491/501 (98%) Strand = Plus / Minus Query: 1 aagagttaagccaggcnnnnnnncttttcttctccggtagaaatctgacttccaggacag 60 |||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 13614 aagagttaagccaggctttttttcttttcttctccggtagaaatctgacttccaggacag 13555 Query: 61 catctgctacaagacccagctctaccagatagacaggtgcaggcccaccaaggagcccta 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13554 catctgctacaagacccagctctaccagatagacaggtgcaggcccaccaaggagcccta 13495 Query: 121 tgaggtgagtggctccccagagcaaaacccgggacctcttaggaagagtggatttccctt 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13494 tgaggtgagtggctccccagagcaaaacccgggacctcttaggaagagtggatttccctt 13435 Query: 181 atgggaagaggactggaaaggaagccagttgttatgggacatggaagtagccagagacaa 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13434 atgggaagaggactggaaaggaagccagttgttatgggacatggaagtagccagagacaa 13375 Query: 241 atacttactcgctttcctgagcccttaagaaatgggtggctcagatggtaaagaatggta 300 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13374 atacttactcactttcctgagcccttaagaaatgggtggctcagatggtaaagaatggta 13315 Query: 301 aagaatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtgggga 360 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 13314 aagaatggtaaagaatctgcctgcaatgctggaaatccgggttcagtccctgggtgggga 13255 Query: 361 agatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacg 420 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 13254 agatcccccggagaagggaatggctacccacaccagtattcatgcctagagaataccacg 13195 Query: 421 gacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaag 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13194 gacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaag 13135 Query: 481 cgactcacactttcactttgt 501 ||||||||||||||||||||| Sbjct: 13134 cgactcacactttcactttgt 13114 Score = 137 bits (69), Expect = 7e-30 Identities = 126/145 (86%) Strand = Plus / Plus Query: 304 aatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaaga 363 ||||||||||| ||||||||||||| | |||||||||| ||||||||| ||||||| Sbjct: 85683 aatggtaaagagcctgcctgcaatgcagacgacccgggttcgatccctgggtcgggaaga 85742 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| |||||||| |||||| ||||||||||| |||| ||||| |||||| || |||| Sbjct: 85743 tcccctggagaaggaaatggcaacccactccaggattcttgcctggagaatcccctggac 85802 Query: 424 aggggagcctggcgggctacagtcc 448 || |||||||||||||||||||||| Sbjct: 85803 agaggagcctggcgggctacagtcc 85827 Score = 131 bits (66), Expect = 4e-28 Identities = 120/138 (86%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||| ||| ||| |||| | |||| |||||||| |||||||||| Sbjct: 64688 gtaaagaatctgcctgcagtgcaggagacccagattcaccccctgggtcaggaagatccc 64629 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| | Sbjct: 64628 ctggagaaggaaatggcaacccactccagtattcttgcctggagaattccatggacagag 64569 Query: 428 gagcctggcgggctacag 445 |||||||| ||||||||| Sbjct: 64568 gagcctggtgggctacag 64551 Score = 123 bits (62), Expect = 1e-25 Identities = 104/118 (88%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||| ||| || ||||||||||| ||| ||| ||||||||||||||||| ||||||||| Sbjct: 71319 tggtagagagtcagcctgcaatgcaggagacctgggttcagtccctgggttgggaagatc 71378 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||| ||||||||||||||||||||||||| ||||| |||||| ||| |||| Sbjct: 71379 ccctggagatgggaatggctacccactccagtatttttgcctggagaattccatggac 71436 Score = 121 bits (61), Expect = 4e-25 Identities = 145/173 (83%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| ||| ||| || |||| ||||||||||||| |||||||| Sbjct: 712 tggtaaagaatctgcctgcagtgcaggagacacgggctcagtccctgggtcaggaagatc 653 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| ||| ||| |||||| ||||||| |||||||| ||||| || ||| |||||||| | Sbjct: 652 ccctggaagaggaaatggcaacccacttcagtattcctgcctggaaaattccacggaccg 593 Query: 426 gggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||||| ||| ||||| ||| |||||| | ||||||| || |||||||| Sbjct: 592 aggagcctgtcggactacaatccatagggtcgcaaagagtcagacacaactga 540 Score = 113 bits (57), Expect = 1e-22 Identities = 132/157 (84%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||||||||||||| || ||| || || ||||||| | |||||||||||| Sbjct: 34599 aaagaatctgcctgcaatgcaagagacctggatttgatccctggtttgggaagatcccct 34540 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||||| ||||| |||||||||||||||| | | | |||||| ||| |||||| ||| Sbjct: 34539 ggagaagggcatggcaacccactccagtattcttacttggagaatcccatggacagagga 34480 Query: 430 gcctggcgggctacagtccctagggttgaaaagagtt 466 |||||| |||||||||||| | || ||| |||||||| Sbjct: 34479 gcctggtgggctacagtccatgggattgcaaagagtt 34443 Score = 109 bits (55), Expect = 2e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||| | ||||||| ||| ||| |||| |||| ||||||||| ||||||||||| Sbjct: 17358 gtaaagaacccgcctgcagtgcaggacacccaggtttgatccctgggttgggaagatccc 17299 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat 414 | |||||||||||||||||||||||||||| ||| |||||||||||| Sbjct: 17298 ctggagaagggaatggctacccactccagtgttcttgcctagagaat 17252 Score = 107 bits (54), Expect = 6e-21 Identities = 120/142 (84%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||| |||||||| |||| ||| || | |||| ||||||||| ||| ||||| Sbjct: 41737 ggtaaagaacctgcctgccatgcaggagactcaggtttgatccctgggtcaggatgatcc 41796 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 | ||||||||| ||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 41797 tctggagaagggcatggcaacccactccagtattcttgcctggagaatgccatggacaga 41856 Query: 427 ggagcctggcgggctacagtcc 448 ||||||||| |||||||||||| Sbjct: 41857 ggagcctggagggctacagtcc 41878 Score = 107 bits (54), Expect = 6e-21 Identities = 120/140 (85%), Gaps = 4/140 (2%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| ||||||||||||||| ||| |||||||||||| |||| Sbjct: 97930 tccctgggtcaggaagatcccctggagaagggaatggcaacctactccagtattcttgcc 97871 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttga-aaagagt 465 | |||||| ||| ||||| ||||||||||||||||||||| | ||| | | ||||||| Sbjct: 97870 tggagaatcccatggaca---gagcctggcgggctacagtccatgggggtcacaaagagt 97814 Query: 466 tggatacaactgaagcgact 485 ||||| |||||||||||| Sbjct: 97813 cggataggactgaagcgact 97794 Score = 105 bits (53), Expect = 3e-20 Identities = 131/157 (83%) Strand = Plus / Minus Query: 313 gaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccgga 372 ||||||||||||| || |||||||| |||| ||| ||||| |||||||||| | ||| Sbjct: 67807 gaatctgcctgcagtgtgggaaaccctggtttgatccttgggttgggaagatcctctgga 67748 Query: 373 gaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcc 432 |||||||||||| ||||||| || | ||| ||||| |||||| || ||||||| | |||| Sbjct: 67747 gaagggaatggcaacccactacaatgttcttgcctggagaattcctcggacagagaagcc 67688 Query: 433 tggcgggctacagtccctagggttgaaaagagttgga 469 ||| |||||| ||||| | |||||| ||||||||||| Sbjct: 67687 tggtgggctatagtccgtggggttgcaaagagttgga 67651 Score = 99.6 bits (50), Expect = 2e-18 Identities = 101/118 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||| ||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 33231 tggtaaagaatctgcctacaatgtgggagacctgggttccatccctgggttgggaagatc 33290 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || ||||||||||| ||||||||||| |||||||| |||| |||||| ||| |||| Sbjct: 33291 acctggagaagggaaaggctacccacttcagtattctggcctggagaatcccatggac 33348 Score = 95.6 bits (48), Expect = 2e-17 Identities = 87/100 (87%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||| ||||| | ||||||| |||||||||||||||| |||||| ||||| Sbjct: 65956 cctgggttgggaggatcctctagagaaggaaatggctacccactcctgtattcttgcctg 65897 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 |||||| ||| |||||| |||||||||| ||||||||||| Sbjct: 65896 gagaatcccatggacagaggagcctggcaggctacagtcc 65857 Score = 95.6 bits (48), Expect = 2e-17 Identities = 99/116 (85%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 |||||||||||||||||| |||||||||||| |||| |||| ||||| ||||||| || Sbjct: 20120 cgggttcagtccctgggtcgggaagatcccctggaggagggcatggcaccccactctggt 20061 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagg 453 |||| | | | |||||| ||| |||||| |||||||||| ||||||||||| |||| Sbjct: 20060 attctttcttggagaatcccatggacagaggagcctggcaggctacagtccgtagg 20005 Score = 93.7 bits (47), Expect = 1e-16 Identities = 116/139 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| | || ||||| |||||||||||||||| ||| Sbjct: 80632 tccctgggttgggaagatcccctggaggaaggcatggcaacccactccagtattctggcc 80573 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||||||||||||| || || |||||| ||| || ||||||| Sbjct: 80572 tggagaatcccatggacaggggagcctggtggactgcagtccatagagtcacaaagagtc 80513 Query: 467 ggatacaactgaagcgact 485 ||| | |||||||||||| Sbjct: 80512 ggacatgactgaagcgact 80494 Score = 93.7 bits (47), Expect = 1e-16 Identities = 120/143 (83%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| || ||||||||||| | ||| | ||||||| ||| ||||| || ||||| Sbjct: 99312 atggtaaaggatttgcctgcaatg-tagaagactgggttcaatccttgggttggaaagat 99254 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| ||||| ||||||||| |||| |||||| ||| ||||| Sbjct: 99253 cccctggagaagggaatggccacccattccagtatttttgcccggagaatcccatggaca 99194 Query: 425 ggggagcctggcgggctacagtc 447 | ||||||||| ||||| ||||| Sbjct: 99193 gaggagcctggtgggctgcagtc 99171 Score = 91.7 bits (46), Expect = 4e-16 Identities = 100/118 (84%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| |||||||||||||||||||||| || | ||| |||||| |||||||||||||| Sbjct: 84588 ggttcaatccctgggtggggaagatcccctgggggaggcaatggcaacccactccagtat 84647 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 || ||||| || ||| | | |||||| |||||| ||| || |||||||| | |||||| Sbjct: 84648 tcttgcctggaaaatccaaaggacagaggagcccggcagggtacagtccatggggttg 84705 Score = 91.7 bits (46), Expect = 4e-16 Identities = 82/94 (87%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| ||||||||||||||||||||||||||| |||| | || Sbjct: 25266 tccctgggtcaggaagatcccctggagaagggaatggctacccactccagaattctttcc 25207 Query: 407 tagagaataccacggacaggggagcctggcgggc 440 | ||||| ||| |||||| ||||||||| |||| Sbjct: 25206 tggagaaccccagggacagaggagcctggagggc 25173 Score = 85.7 bits (43), Expect = 2e-14 Identities = 119/143 (83%), Gaps = 1/143 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||| ||| || || || |||| |||||||||||| |||||| Sbjct: 62950 tggtaaagaatccgcctgcagtgcacgagactcgagttccatccctgggtggg-aagatc 63008 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 || |||||||| |||||| ||| ||||||| |||| ||||| | |||| ||| |||||| Sbjct: 63009 ccttggagaaggaaatggcaacctactccagcattcttgcctggggaatcccatggacag 63068 Query: 426 gggagcctggcgggctacagtcc 448 || |||||||||||||||||| Sbjct: 63069 aagaacctggcgggctacagtcc 63091 Score = 85.7 bits (43), Expect = 2e-14 Identities = 95/111 (85%), Gaps = 1/111 (0%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||||||| ||||| ||| ||||| || |||||||| |||| | ||||||||||||| Sbjct: 21433 gggttcagtccttgggttggggagatctcctggagaaggaaatgacaacccactccagta 21492 Query: 399 ttcatgcctagagaatacca-cggacaggggagcctggcgggctacagtcc 448 | | ||||| || ||| ||| |||||| |||||||||||||||||||||| Sbjct: 21493 tccttgcctggaaaatcccatgggacagaggagcctggcgggctacagtcc 21543 Score = 81.8 bits (41), Expect = 4e-13 Identities = 86/101 (85%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||| ||||||| ||||| | | | ||||||| ||||| ||||||||||||||| |||| Sbjct: 51188 tcccagggtgggtaagattctctgaagaagggcatggcagcccactccagtattcttgcc 51247 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtc 447 | |||||| ||| |||||| |||||||||| |||||||||| Sbjct: 51248 tggagaatcccatggacagaggagcctggccggctacagtc 51288 Score = 81.8 bits (41), Expect = 4e-13 Identities = 92/109 (84%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| | ||||||| || | || |||| ||||| ||||| |||||||| Sbjct: 32073 ggttcaatccctgggtcgagaagatctcctgaaggagggcatggcaacccattccagtat 32132 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 || ||||| |||||| ||| ||||| || ||||||| |||||||||||| Sbjct: 32133 tcttgcctggagaatcccatggacatggcagcctggtgggctacagtcc 32181 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||| ||||| Sbjct: 2263 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacggggga 2322 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 2323 gcctggtgggct 2334 Score = 75.8 bits (38), Expect = 2e-11 Identities = 80/94 (85%) Strand = Plus / Plus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||||| ||||||||| ||||||||||| |||| |||| ||||| |||||||||||| Sbjct: 89804 cgggttcgatccctgggtcaggaagatcccctggaggagggcatggcaacccactccagt 89863 Query: 398 attcatgcctagagaataccacggacaggggagc 431 || | ||||| |||||| ||| |||||| ||||| Sbjct: 89864 atccttgcctggagaatcccatggacagaggagc 89897 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 75804 ggagaaggcaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 75863 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 75864 gcctggtgggct 75875 Score = 69.9 bits (35), Expect = 1e-09 Identities = 119/147 (80%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 |||||| |||||||||| ||||||| ||| || | ||| ||| | ||||||||||||| Sbjct: 94228 gggttcggtccctgggtcaggaagatgccctggtggaggtcatgacaacccactccagta 94169 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 ||| ||||| |||||| | | ||| || |||| |||| |||||||||| |||||| | Sbjct: 94168 ttcttgcctggagaattctatggatagaggaggttggcaagctacagtccatagggtcgc 94109 Query: 459 aaagagttggatacaactgaagcgact 485 ||||||||||| ||| |||||| |||| Sbjct: 94108 aaagagttggacacagctgaagtgact 94082 Score = 67.9 bits (34), Expect = 6e-09 Identities = 113/138 (81%), Gaps = 1/138 (0%) Strand = Plus / Plus Query: 311 aagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccg 370 |||| |||||||||||||| ||| ||| |||||| | ||||||| ||||||||||| | Sbjct: 18773 aagagtctgcctgcaatgcaggagacctgggttcgattcctgggtcaggaagatcccctg 18832 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacag-ggga 429 ||| ||| |||||| ||| |||||||||| | || | |||||| ||| |||||| | || Sbjct: 18833 gagcaggaaatggcaacctactccagtatccttgaccggagaatcccatggacagagaga 18892 Query: 430 gcctggcgggctacagtc 447 ||||||| | |||||||| Sbjct: 18893 gcctggcagactacagtc 18910 Score = 67.9 bits (34), Expect = 6e-09 Identities = 85/102 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| ||| |||||||| ||| |||| Sbjct: 7168 tccctgggttgggaagatcccgtggagaaggaaatggcaacctactccagtgttcttgcc 7109 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| | |||| |||||||||| |||| |||||| Sbjct: 7108 tcggaaattccatgaacagaggagcctggcaggctgcagtcc 7067 Score = 65.9 bits (33), Expect = 2e-08 Identities = 84/101 (83%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||| | ||||||| ||| | | ||||| ||||||||| ||||| |||| Sbjct: 58705 ggtaaagaatctgaccgcaatgcaggagatgcaggttcgatccctgggttgggaacatcc 58646 Query: 367 cccggagaagggaatggctacccactccagtattcatgcct 407 || |||| ||| |||||| |||||||||||| ||| ||||| Sbjct: 58645 cctggaggaggaaatggcaacccactccagtgttcttgcct 58605 Score = 63.9 bits (32), Expect = 9e-08 Identities = 80/96 (83%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||||| |||||||||| ||||| ||||| | ||| ||| |||||| ||| Sbjct: 98460 ggagaaggaaatggaaacccactccactattcttgcctgggaaatcccatggacagagga 98519 Query: 430 gcctggcgggctacagtccctagggttgaaaagagt 465 ||||| |||||||||||| ||||||| ||||||| Sbjct: 98520 gcctgttgggctacagtccacagggttgcaaagagt 98555 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| || ||| Sbjct: 47909 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatagagga 47968 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 47969 gcctggtgggct 47980 Score = 61.9 bits (31), Expect = 3e-07 Identities = 80/95 (84%), Gaps = 1/95 (1%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||| |||||||| |||| ||| |||||| |||||| ||||||||| ||||| Sbjct: 97563 cctgggttggggagatcccctggaggaggaaatggcaacccaccccagtattcttgcctg 97622 Query: 409 gagaatacc-acggacaggggagcctggcgggcta 442 |||| | || | || ||| |||||||||||||||| Sbjct: 97623 gagattccccatgggcagtggagcctggcgggcta 97657 Score = 60.0 bits (30), Expect = 1e-06 Identities = 60/70 (85%) Strand = Plus / Plus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||||| ||||| Sbjct: 94616 agaaggaaatggcagcccactccagtgttcttgcctggagaatcccagggacagcggagc 94675 Query: 432 ctggcgggct 441 |||| ||||| Sbjct: 94676 ctggtgggct 94685 Score = 58.0 bits (29), Expect = 5e-06 Identities = 65/77 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| ||||| ||||| | || |||| Sbjct: 27008 tccctgggtcgggaagatcccctggaggagggcatggcaacccattccaggactcctgcc 27067 Query: 407 tagagaataccacggac 423 | |||||| ||| |||| Sbjct: 27068 tggagaatcccatggac 27084 Score = 58.0 bits (29), Expect = 5e-06 Identities = 44/49 (89%) Strand = Plus / Minus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 |||||| ||||||| |||| ||||||||||| |||||| |||||||||| Sbjct: 61567 ctgggttgggaagaccccctggagaagggaaaggctacacactccagta 61519 >gb|CM000182| Bos taurus chromosome 6-FRAG[91530000,91629999] Length = 100000 Score = 202 bits (102), Expect = 1e-49 Identities = 163/182 (89%), Gaps = 1/182 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctgga-aacccgggttcagtccctgggtggggaaga 363 ||||||||||||||||||||||| ||||| |||| ||||||| ||||||||| ||||||| Sbjct: 65521 atggtaaagaatctgcctgcaattctggagaacctgggttcaatccctgggttgggaaga 65580 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| ||||||||||||||| |||||||||||||||| ||||| |||||| ||| |||| Sbjct: 65581 tcccctggagaagggaatggcaacccactccagtattcttgcctggagaatcccatggac 65640 Query: 424 aggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcga 483 || ||||||||||||||| |||| | || ||| ||||||||||||| || |||||||||| Sbjct: 65641 agaggagcctggcgggctgcagttcatacggtggaaaagagttggacacgactgaagcga 65700 Query: 484 ct 485 || Sbjct: 65701 ct 65702 Score = 174 bits (88), Expect = 3e-41 Identities = 127/140 (90%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||| Sbjct: 58092 taaagaatctgcctgcaatgcaggaaacctgggttcagtccctgggtggagaagatcccc 58151 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||| |||| ||||| |||||||||||||||| ||||| |||||| ||||| |||| || Sbjct: 58152 tggaggagggcatggcaacccactccagtattcttgcctggagaatcccacgcacagagg 58211 Query: 429 agcctggcgggctacagtcc 448 ||||||||||||| |||||| Sbjct: 58212 agcctggcgggctgcagtcc 58231 Score = 133 bits (67), Expect = 1e-28 Identities = 140/163 (85%), Gaps = 1/163 (0%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| ||| |||||| |||||||||| |||||||||| Sbjct: 99146 gtaaagaatctgcctgcaatgcgggagacctgggttcggtccctgggttgggaagatcct 99205 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggacagg 426 | ||| |||| ||||| | |||||||||||||| ||||| |||||| ||| |||||| Sbjct: 99206 ctggaagagggcatggcaaaccactccagtattcttgcctggagaatccccatggacaga 99265 Query: 427 ggagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||||||||||| |||||| | | |||| ||||||||||| Sbjct: 99266 ggagcctggcgggctgcagtccttggcgttgcaaagagttgga 99308 Score = 129 bits (65), Expect = 2e-27 Identities = 140/165 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||| ||||||||| | ||| ||| ||||| ||||||||| |||||||| Sbjct: 89131 atggtaaagaacctgcctgcattcagggagacctaggttcgatccctgggttgggaagat 89190 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||| ||||||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 89191 cccctggagaagggaacagctacccactccagtattcttgcctggagaatcccatggaca 89250 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | ||||||| ||| |||||||||| | |||| | ||||||||||| Sbjct: 89251 gaggagcctagcgagctacagtccatggggtcgcaaagagttgga 89295 Score = 121 bits (61), Expect = 4e-25 Identities = 113/129 (87%), Gaps = 1/129 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| || || | ||| ||||| |||||||| Sbjct: 2053 atggtaaagaatctgcctgcaatgcaggagacctggtttga-tccttgggttgggaagat 2111 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||| ||||||| ||| ||||| |||||| ||| ||||| Sbjct: 2112 cccctggagaagggaatggctacccgctccagtgttcttgcctggagaattccaaggaca 2171 Query: 425 ggggagcct 433 | ||||||| Sbjct: 2172 gaggagcct 2180 Score = 113 bits (57), Expect = 1e-22 Identities = 145/173 (83%), Gaps = 1/173 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| |||||||||| ||| ||||||||| ||||||||| ||||||| | Sbjct: 35293 ggtaaagaatccacctgcaatgcaggagacccgggtttgatccctgggttgggaagagtc 35352 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||||||| |||||||||||||||| ||||||| ||||| |||||| ||| ||||| Sbjct: 35353 cctggagaagagaatggctacccactctagtattcttgcctggagaattccatagacaga 35412 Query: 427 ggagcctggcgggctacagtccctagggttg-aaaagagttggatacaactga 478 |||||||| | |||| |||||| | |||||| |||||||| || |||||||| Sbjct: 35413 ggagcctgacaggctgcagtccatggggttgcaaaagagtcagacacaactga 35465 Score = 109 bits (55), Expect = 2e-21 Identities = 97/111 (87%) Strand = Plus / Plus Query: 315 atctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggaga 374 ||||||||||||||| ||| ||||||||||| ||| ||||| ||||||||||| ||||| Sbjct: 67521 atctgcctgcaatgcaggagacccgggttcaatccttgggtctggaagatcccctggaga 67580 Query: 375 agggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||||||||| |||||||||||| |||| |||| |||||| ||| |||||| Sbjct: 67581 agggaatggttacccactccaggattctagcctggagaattccatggacag 67631 Score = 107 bits (54), Expect = 6e-21 Identities = 90/102 (88%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 63164 tggtaaagaatctgcctgcaatgtgggagacctgggttcgatccctgggttgggaagatc 63223 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcct 407 ||| ||||||||||| |||||||||||| |||||| ||||| Sbjct: 63224 ccctggagaagggaaaggctacccactctggtattcttgcct 63265 Score = 105 bits (53), Expect = 3e-20 Identities = 120/141 (85%), Gaps = 1/141 (0%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||| |||||| ||| ||| |||| ||||| ||||||||||||||||||||| Sbjct: 32464 gtaaagaatct-cctgcagtgcaggagacccaggttcgatccctgggtggggaagatccc 32522 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | | |||| |||||||| |||| ||||||||||| ||||| |||||| ||| |||||| | Sbjct: 32523 ctgaagaaaggaatggcaaccccctccagtattcttgcctggagaattccatggacagag 32582 Query: 428 gagcctggcgggctacagtcc 448 || ||| ||||||| ||||| Sbjct: 32583 gactctgacgggctatagtcc 32603 Score = 101 bits (51), Expect = 4e-19 Identities = 105/123 (85%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||||||||||||||| | |||||| | |||||| ||||||||||||||| |||| Sbjct: 28672 tccctgggtggggaagatcctctggagaaagaaatggcaacccactccagtatttttgcc 28613 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| |||||||| | ||||||||||| | || | | |||||||| Sbjct: 28612 tggagaattccatggacagaggagcctgtcaggctacagtccatgggatcgcaaagagtt 28553 Query: 467 gga 469 ||| Sbjct: 28552 gga 28550 Score = 101 bits (51), Expect = 4e-19 Identities = 93/107 (86%) Strand = Plus / Plus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||||||||||||| ||||||||| || |||| |||| ||||| |||||||| |||| || Sbjct: 6220 ttcagtccctgggttgggaagatctcctggaggagggcatggcaacccactctagtactc 6279 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||| |||||| ||| |||||| ||||||||||||| |||||||| Sbjct: 6280 ttgcctggagaatcccatggacagaggagcctggcgggttacagtcc 6326 Score = 99.6 bits (50), Expect = 2e-18 Identities = 89/102 (87%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||||||| ||| |||| ||| |||| ||||| |||||||||||||||| ||| Sbjct: 94073 tccctgggtggggcagaacccctagaggagggcatggcaacccactccagtattcttgct 94014 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| |||||||||| ||||||||| |||||||||||| Sbjct: 94013 tggagaatcccacggacagaggagcctggtgggctacagtcc 93972 Score = 97.6 bits (49), Expect = 6e-18 Identities = 109/129 (84%) Strand = Plus / Minus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| || |||||| ||||||| ||| |||| |||| ||||||||||| ||||||| | Sbjct: 62073 gttcaatctctgggtcaggaagatgccctggaggagggcatggctacccattccagtact 62014 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaa 460 | ||||| |||||| ||| ||| || ||||||||||||||| |||||| | |||||| || Sbjct: 62013 cttgcctggagaatcccatggatagaggagcctggcgggcttcagtccatggggttgcaa 61954 Query: 461 agagttgga 469 ||||||||| Sbjct: 61953 agagttgga 61945 Score = 93.7 bits (47), Expect = 1e-16 Identities = 86/99 (86%) Strand = Plus / Plus Query: 387 cccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagt 446 ||||||||||||||| ||||| |||||| |||||||||| ||||||||| |||||||||| Sbjct: 83797 cccactccagtattcttgcctggagaatcccacggacagaggagcctggtgggctacagt 83856 Query: 447 ccctagggttgaaaagagttggatacaactgaagcgact 485 || | |||| | | ||||| ||| || |||||||||||| Sbjct: 83857 ccatggggtcgcacagagtcggacacgactgaagcgact 83895 Score = 91.7 bits (46), Expect = 4e-16 Identities = 110/130 (84%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 320 cctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc-ggagaaggg 378 |||||||||| ||| |||| ||||| ||||||||| ||||||| | || |||| |||| Sbjct: 12983 cctgcaatgcgggagaccctggttcgatccctgggtcaggaagattctcctggaggaggg 12924 Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 ||||| |||||||||||||||| ||||| |||||| ||| || ||| ||||||||| || Sbjct: 12923 catggcaacccactccagtattcttgcctggagaatcccatgggcagaggagcctggagg 12864 Query: 439 gctacagtcc 448 |||||||||| Sbjct: 12863 gctacagtcc 12854 Score = 89.7 bits (45), Expect = 2e-15 Identities = 94/109 (86%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||||||| ||| | | ||||||| || |||||| ||||||||| Sbjct: 47500 tggtaaagaatctgcctgcaatgtgggagatctgggttcaatctctgggttgggaagatc 47559 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||| ||||||||||| || |||||| |||||||||| |||| |||||| Sbjct: 47560 ccctggagaagggaaagg-tacccagtccagtattctggcctggagaat 47607 Score = 85.7 bits (43), Expect = 2e-14 Identities = 134/163 (82%), Gaps = 1/163 (0%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| ||||||||||| ||| ||| |||||| |||||| || |||||||||| Sbjct: 12038 ggtaaagaatccgcctgcaatgcgggagacctgggttcgatccctgagttgggaagatcc 11979 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||| | || |||| |||||||||||||||| || || |||||| ||| |||||| Sbjct: 11978 cctggaagaaggcatggtaacccactccagtattcttg-ctggagaattccatggacaga 11920 Query: 427 ggagcctggcgggctacagtccctagggttgaaaagagttgga 469 || ||| || ||||||||||| || |||| | ||||| ||||| Sbjct: 11919 ggggcccggagggctacagtcactggggtcgcaaagatttgga 11877 Score = 83.8 bits (42), Expect = 9e-14 Identities = 87/102 (85%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| ||| |||| ||||||||||| |||| || | Sbjct: 51898 tccctgggttgggaagatcccctggaggggggcatggaaacccactccaggattcttggc 51839 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 |||||||| ||| |||||| | ||||||| |||||||||||| Sbjct: 51838 tagagaatcccatggacagagaagcctggtgggctacagtcc 51797 Score = 83.8 bits (42), Expect = 9e-14 Identities = 90/106 (84%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||| ||||||||||| ||| ||| ||||| ||||||||| |||||||||||| Sbjct: 39450 taaagaatccgcctgcaatgcgggagacctgggtttcatccctgggttgggaagatcccc 39509 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||||| | ||||||||||| ||||| |||| |||||| Sbjct: 39510 tggagaagggaaaaggtacccactccactattctggcctggagaat 39555 Score = 79.8 bits (40), Expect = 1e-12 Identities = 58/64 (90%) Strand = Plus / Plus Query: 351 tgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctaga 410 ||||| |||||||||||| ||| ||||||||||||||||||||||||||| ||||| || Sbjct: 20997 tgggttgggaagatcccctggaaaagggaatggctacccactccagtattgttgcctgga 21056 Query: 411 gaat 414 |||| Sbjct: 21057 gaat 21060 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| |||| |||||| | ||||| | ||||||||| Sbjct: 99025 tggtaaagaatcctcctgcaatgcaggagacccaggttcaattcctggattgggaagatc 99084 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||| |||||||||||| ||||||| Sbjct: 99085 ccctggagaaggggtaggctacccactcgagtattc 99120 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| |||||| | | || |||||||| |||||| Sbjct: 16179 tggtaaagaatctgcctgcaatgcaggaaacaccagatcgatccctgggcctggaagagt 16238 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||||||||| |||||||||||||||| Sbjct: 16239 ccctggagaagggaatggcaacccactccagtattc 16274 Score = 77.8 bits (39), Expect = 6e-12 Identities = 91/107 (85%), Gaps = 1/107 (0%) Strand = Plus / Plus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||||||||||||| || ||||| ||| |||| || |||||| ||||||||| ||||| Sbjct: 62704 ttcagtccctgggttggaaagattccctggagggggaaatggcaacccactcct-tattc 62762 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||| |||||| ||| |||||| ||||||||| |||||||||||| Sbjct: 62763 ttgcctggagaatcccatggacagaggagcctggtgggctacagtcc 62809 Score = 77.8 bits (39), Expect = 6e-12 Identities = 75/87 (86%) Strand = Plus / Minus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| |||||||| |||| | |||||||||||||||| ||||| || ||| ||| || Sbjct: 68640 gatcccctggagaaggaaatgcccacccactccagtattcttgcctggaaaattccatgg 68581 Query: 422 acaggggagcctggcgggctacagtcc 448 |||| |||||| || |||||||||||| Sbjct: 68580 acagaggagcccggtgggctacagtcc 68554 Score = 75.8 bits (38), Expect = 2e-11 Identities = 110/134 (82%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||| ||||| |||||||| ||| || | ||||||||||||| ||||| |||||| Sbjct: 7889 gggaagttcccctggagaaggcaatagcaaaccactccagtatttttgcctggagaatct 7830 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaact 476 || |||||| |||| |||| ||| ||||||| |||||| | ||||||||||| |||||| Sbjct: 7829 catggacagaagagcttggcaggccacagtccatagggtggcaaagagttggacacaact 7770 Query: 477 gaagcgactcacac 490 |||| ||| |||| Sbjct: 7769 taagcaacttacac 7756 Score = 75.8 bits (38), Expect = 2e-11 Identities = 77/90 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||||| ||| ||| ||||||| ||||| ||| | ||||||| Sbjct: 22896 tggtaaagaatccgcctgcaatgcaggagacctgggttcaatccctaggttgagaagatc 22955 Query: 366 ccccggagaagggaatggctacccactcca 395 ||| ||||||| ||| | ||||||| |||| Sbjct: 22956 ccctggagaagcgaaagcctacccagtcca 22985 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 24241 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 24182 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 24181 gcctggtgggct 24170 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||| | ||| ||| | |||| | ||| ||| || |||||| Sbjct: 22777 tggtaaagaatctgcctgcaattcaggagacctcgattcaattcctaggtcggaaagatc 22836 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | |||||||||| |||||||||||||||||||| Sbjct: 22837 cgctggagaagggataggctacccactccagtattc 22872 Score = 69.9 bits (35), Expect = 1e-09 Identities = 68/79 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||| || ||||| |||| |||||||||| ||||| |||||| || |||||| ||| Sbjct: 26463 ggagaagagagtggctccccagtccagtattcttgcctggagaattacatggacagagga 26404 Query: 430 gcctggcgggctacagtcc 448 ||||||| ||||||||||| Sbjct: 26403 gcctggcaggctacagtcc 26385 Score = 65.9 bits (33), Expect = 2e-08 Identities = 81/97 (83%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||| || ||| || ||| |||||| || |||||| || |||| Sbjct: 59586 atggtaaagaatctgcctacagtgcctgagacctgggttcgatctctgggtcaggtagat 59527 Query: 365 cccccggagaagggaatggctacccactccagtattc 401 |||| ||||| || |||||| |||||||||||||||| Sbjct: 59526 cccctggagagggcaatggcaacccactccagtattc 59490 Score = 63.9 bits (32), Expect = 9e-08 Identities = 89/108 (82%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| | || ||| ||||| ||||||||||| ||| |||||||||||| || Sbjct: 53901 ggaagatcccctgcaggaggaaatggtgccccactccagtgttcttgcctagagaatccc 53842 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| | |||| || ||||| |||||| |||||| | ||||||| Sbjct: 53841 atggacagagaagccgggtgggctgcagtccatagggtcgcaaagagt 53794 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 19503 ggagaaggaaatggaaacccactccagtgttcttgcctggagaatcccagggacggggga 19562 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 19563 gcctggtgggct 19574 Score = 58.0 bits (29), Expect = 5e-06 Identities = 35/37 (94%) Strand = Plus / Plus Query: 371 gagaagggaatggctacccactccagtattcatgcct 407 |||||||||||||| |||||||||||||||| ||||| Sbjct: 35576 gagaagggaatggcaacccactccagtattcctgcct 35612 >gb|CM000187| Bos taurus chromosome 11-FRAG[1710000,1809999] Length = 100000 Score = 198 bits (100), Expect = 2e-48 Identities = 142/156 (91%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||| Sbjct: 74124 ggtaaagaatctgcctgcaatgcaggaaacccgggttcaatccctgggtcgggaagatcc 74183 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 74184 cctggagaaggaaatggcaacccactccagtattcttgcctggagaatcccatggacaga 74243 Query: 427 ggagcctggcgggctacagtccctagggttgaaaag 462 ||||||||| |||||||||||| | ||||||||||| Sbjct: 74244 ggagcctggagggctacagtccatggggttgaaaag 74279 Score = 131 bits (66), Expect = 4e-28 Identities = 123/142 (86%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||| ||| ||| || | ||||| ||| |||||| ||| |||| | Sbjct: 17008 ggtaaagaatctgcctgcagtgcaggagacgcaggttcggtctctgggttgggcagattc 16949 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||||||||||||||| ||||||||| |||||| ||||| |||||| ||| |||||| Sbjct: 16948 cctggagaagggaatggcaacccactcctgtattcttgcctggagaatcccatggacaga 16889 Query: 427 ggagcctggcgggctacagtcc 448 |||||||||||| ||||||||| Sbjct: 16888 ggagcctggcggactacagtcc 16867 Score = 125 bits (63), Expect = 3e-26 Identities = 120/139 (86%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||||||||||||| ||| ||| ||||||| || |||||| | |||||||||| Sbjct: 38071 aaagaatctgcctgcaatgcaggagacctgggttcaatctctgggttgagaagatcccct 38012 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||| ||||||||| ||||||||||||| || ||||| |||||| ||| |||||| ||| Sbjct: 38011 ggagatgggaatggcaacccactccagtaatcttgcctggagaattccatggacagagga 37952 Query: 430 gcctggcgggctacagtcc 448 ||||| || ||||||||| Sbjct: 37951 gcctgatggactacagtcc 37933 Score = 109 bits (55), Expect = 2e-21 Identities = 121/143 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||||| || ||| || | |||| ||||||| || |||||||| Sbjct: 31572 tggtaaagaatctgcctgcaacgcaggagacttgagttcggtccctgagtcaggaagatc 31513 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||| |||| ||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 31512 ccctggaggagggcatggcaacccactccagtattcttgcctggagaatcccatggacag 31453 Query: 426 gggagcctggcgggctacagtcc 448 |||||||| ||| |||||||| Sbjct: 31452 aagagcctggtgggttacagtcc 31430 Score = 109 bits (55), Expect = 2e-21 Identities = 91/103 (88%) Strand = Plus / Plus Query: 346 gtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgc 405 |||||||||| |||||||||||| |||||||| |||||| |||||||||||||||| ||| Sbjct: 5868 gtccctgggttgggaagatcccctggagaaggaaatggcaacccactccagtattcttgc 5927 Query: 406 ctagagaataccacggacaggggagcctggcgggctacagtcc 448 || || ||| ||| |||||| |||||||||| ||||| ||||| Sbjct: 5928 ctggaaaatcccatggacagaggagcctggcaggctatagtcc 5970 Score = 101 bits (51), Expect = 4e-19 Identities = 99/115 (86%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||| |||||||||| || ||| |||||| ||||||||| |||||||||||| Sbjct: 65202 taaagaatccacctgcaatgcaagagacctaggttcaatccctgggttgggaagatcccc 65143 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||||||||||||||| |||||||||||||| |||| |||||| ||| |||| Sbjct: 65142 tggagaagggaatggctatccactccagtattctggcctggagaatcccatggac 65088 Score = 101 bits (51), Expect = 4e-19 Identities = 106/123 (86%), Gaps = 1/123 (0%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| ||||||||||||||||||||||| |||||||| |||| Sbjct: 56698 tccctgggtcaggaagatcccctggagaagggaatggctacccact-cagtattcttgcc 56640 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | || ||| ||| | |||| ||||||||| |||||||||||| | |||| |||||||| Sbjct: 56639 tggaaaattccatgcacagaggagcctggtgggctacagtccatggggtcacaaagagtt 56580 Query: 467 gga 469 ||| Sbjct: 56579 gga 56577 Score = 99.6 bits (50), Expect = 2e-18 Identities = 80/90 (88%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||| |||||| ||||||||| ||||||| Sbjct: 51225 atggtaaagaatctgcctgcaatgcaggagacccaggttcaatccctgggtcaggaagat 51166 Query: 365 cccccggagaagggaatggctacccactcc 394 |||| |||||||| ||||| ||||||||| Sbjct: 51165 cccctggagaaggaaatgggaacccactcc 51136 Score = 93.7 bits (47), Expect = 1e-16 Identities = 86/99 (86%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 ||||||||||| |||||||||||||||||||||||||||||||| ||| | ||| | Sbjct: 54219 gggaagatcccttggagaagggaatggctacccactccagtattcttgcacgggaaatcc 54278 Query: 417 cacggacaggggagcctggcgggctacagtccctagggt 455 ||||||||| |||| ||||| ||||||||||| |||||| Sbjct: 54279 cacggacagaggagtctggcaggctacagtccatagggt 54317 Score = 93.7 bits (47), Expect = 1e-16 Identities = 98/115 (85%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| |||||| || |||||||||||| |||| |||| ||| | |||||||||||| Sbjct: 82805 gggttcaatccctgagtcgggaagatcccctggaggagggcatgacaccccactccagta 82746 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagg 453 ||| ||||| |||||| ||| |||||| ||||||||| |||||| ||||| |||| Sbjct: 82745 ttcttgcctggagaatcccaaggacagaggagcctggtgggctatagtccatagg 82691 Score = 89.7 bits (45), Expect = 2e-15 Identities = 69/77 (89%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| |||||||| |||||| | |||||||||||||| ||||| Sbjct: 79458 cctgggtcgggaagatcccctggagaaggaaatggcaatccactccagtattcctgcctg 79399 Query: 409 gagaataccacggacag 425 |||||| |||||||||| Sbjct: 79398 gagaatcccacggacag 79382 Score = 87.7 bits (44), Expect = 6e-15 Identities = 86/100 (86%) Strand = Plus / Plus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||||||||||||| ||| || ||||||| ||||||||| || ||||||||| Sbjct: 28628 aaagaatctgcctgcaatgcaggagacgtgggttcaatccctgggttggaaagatcccct 28687 Query: 370 ggagaagggaatggctacccactccagtattcatgcctag 409 || ||||| ||||| ||||| |||||||||| ||||||| Sbjct: 28688 ggggaaggatatggcaacccattccagtattcttgcctag 28727 Score = 87.7 bits (44), Expect = 6e-15 Identities = 98/116 (84%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 78827 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 78768 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 ||||| ||||| | ||| || |||||| | ||||| ||| || |||||||||||| Sbjct: 78767 tcctggtgggctgctgtctctggggttgcacagagtcggacacgactgaagcgact 78712 Score = 87.7 bits (44), Expect = 6e-15 Identities = 98/116 (84%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 93211 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 93152 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 || ||| ||||||| ||| || |||| | | ||||||||| ||||||||||||||| Sbjct: 93151 gcttggtgggctactgtctctggggtcgcacagagttggacacaactgaagcgact 93096 Score = 83.8 bits (42), Expect = 9e-14 Identities = 90/106 (84%) Strand = Plus / Plus Query: 343 tcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattca 402 |||||||||||| |||||||| |||| |||| | | ||||| |||||||| ||| ||| Sbjct: 29807 tcagtccctgggcggggaagaccccctggaggacagcatggcaacccactctagtgttct 29866 Query: 403 tgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||| |||||| |||| ||||| ||||||||| |||||||||||| Sbjct: 29867 tgcctggagaattccacagacagaggagcctggtgggctacagtcc 29912 Score = 81.8 bits (41), Expect = 4e-13 Identities = 87/101 (86%), Gaps = 1/101 (0%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaatacc-acggacagggg 428 |||||||| |||||| |||||||| ||||||| ||||| |||||| || | || ||| || Sbjct: 75344 ggagaaggaaatggcaacccactctagtattcttgcctggagaatccccatgggcagagg 75285 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||| |||||||||||| | |||||| ||||||||||| Sbjct: 75284 agcctggagggctacagtccatggggttgcaaagagttgga 75244 Score = 79.8 bits (40), Expect = 1e-12 Identities = 119/144 (82%), Gaps = 1/144 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 |||| |||||||||||||| ||||| ||| | | ||||| ||| |||||| |||||||| Sbjct: 58205 tggtgaagaatctgcctgccaatgcaggagatgcaggttcggtctctgggtcgggaagat 58146 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||| ||| |||||| ||||||||||||||| ||||| |||||| | | ||||| Sbjct: 58145 cccgtggaggaggaaatggcaccccactccagtattcttgcctggagaatgcaatggaca 58086 Query: 425 ggggagcctggcgggctacagtcc 448 | | | ||||| |||||||||||| Sbjct: 58085 gagcaacctggtgggctacagtcc 58062 Score = 77.8 bits (39), Expect = 6e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||||||||||| |||||||||||||||| ||||| | | | ||| |||||| ||| Sbjct: 64952 ggagaagggaatggcaacccactccagtattcttgcctgaaaattcccatggacagagga 64893 Query: 430 gcctggcgggctacagtcc 448 |||||| |||||||||||| Sbjct: 64892 gcctggtgggctacagtcc 64874 Score = 77.8 bits (39), Expect = 6e-12 Identities = 96/115 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| ||| ||| |||||| |||||||||| ||||| |||| Sbjct: 99688 tccctgggtcaggaagatcccctagaggaggaaatggcaacccactccactattcctgcc 99629 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaa 461 | | |||| ||| |||||| ||||||||| |||||| ||||| ||||| ||||| Sbjct: 99628 ttgtgaatcccatggacagaggagcctggtgggctatagtccgcagggtggaaaa 99574 Score = 77.8 bits (39), Expect = 6e-12 Identities = 93/111 (83%) Strand = Plus / Plus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 |||||||| ||||||||| |||||||||| |||||||| |||||| |||||||||||| Sbjct: 81154 cgggttcaatccctgggtcaagaagatcccctggagaaggaaatggcaacccactccagt 81213 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 | || | | || ||| ||| |||||| |||||||||| ||||||||||| Sbjct: 81214 actcttctccaggaaatcccatggacagaggagcctggcaggctacagtcc 81264 Score = 75.8 bits (38), Expect = 2e-11 Identities = 87/102 (85%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||| ||| |||||||| |||||| |||||||||||||| | || | Sbjct: 98351 tccctgggtcgggaagataccctggagaaggaaatggcaacccactccagtatgcttg-c 98409 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||||||||| ||||||||||||||||||||| Sbjct: 98410 tgggaaatctcacggacagaagagcctggcgggctacagtcc 98451 Score = 73.8 bits (37), Expect = 9e-11 Identities = 82/97 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||| |||| |||| ||| ||| ||||| ||||||||| |||||||| Sbjct: 49556 atggtaaagaatctgtctgccatgcaggagacctgggtttgatccctgggtagggaagat 49615 Query: 365 cccccggagaagggaatggctacccactccagtattc 401 || | |||||||| ||||| ||||||||||| |||| Sbjct: 49616 ccactggagaaggtcatggcaacccactccagaattc 49652 Score = 71.9 bits (36), Expect = 4e-10 Identities = 96/116 (82%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||| || Sbjct: 43877 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagccga 43818 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||||| | ||||| ||| || |||||||||||| Sbjct: 43817 gcctggtgggctgccgtctatggggttgcacagagtcggacacgactgaagcgact 43762 Score = 71.9 bits (36), Expect = 4e-10 Identities = 70/80 (87%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 |||||||||||||||| ||||| |||||| ||| |||||| ||||||||||||||||| Sbjct: 58603 acccactccagtattcttgcctggagaatcccatggacagaagagcctggcgggctaca- 58545 Query: 446 tccctagggttgaaaagagt 465 ||| | |||| ||||||||| Sbjct: 58544 tccatggggtcgaaaagagt 58525 Score = 71.9 bits (36), Expect = 4e-10 Identities = 60/68 (88%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 ||||||| ||||||||||||||||||||| ||| ||| ||||| |||||||||||||| Sbjct: 95733 ggttcaggccctgggtggggaagatcccctggacgaggacatggcaacccactccagtat 95792 Query: 400 tcatgcct 407 || ||||| Sbjct: 95793 tcttgcct 95800 Score = 71.9 bits (36), Expect = 4e-10 Identities = 88/104 (84%), Gaps = 1/104 (0%) Strand = Plus / Minus Query: 341 gttcagtccctgggtggggaagatccccc-ggagaagggaatggctacccactccagtat 399 ||||| ||||||||| ||||||| || | |||||||| |||||| |||||||||||||| Sbjct: 80328 gttcaatccctgggtcaggaagattccactggagaaggaaatggcaacccactccagtat 80269 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctac 443 || |||| ||| ||| ||| |||||| | ||||||| ||||||| Sbjct: 80268 tcttgccaagataatcccatggacagagaagcctggggggctac 80225 Score = 71.9 bits (36), Expect = 4e-10 Identities = 84/100 (84%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| |||||||| |||||| ||||||| |||||||| ||||| Sbjct: 78124 cctgggtcaggaagatcccctggagaaggaaatggcaacccacttcagtattcttgcctg 78183 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 | ||| ||| ||||| ||||||||||||| || ||||| Sbjct: 78184 ggaaattccatagacagaggagcctggcgggttagagtcc 78223 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||| |||||| || |||| ||||| | ||||||| ||||||||| Sbjct: 65324 tggtaaagaatctgcctacaatgcaagagaccctggttcgattcctgggtcgggaagatc 65265 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | |||||||||| |||||| ||||||||||||| Sbjct: 65264 tgctggagaagggataggctacacactccagtattc 65229 Score = 69.9 bits (35), Expect = 1e-09 Identities = 101/123 (82%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || |||||||| ||| |||| ||| ||| || | |||||||||||||| |||| Sbjct: 88646 tccctgagttgggaagatgccctggaggaggaaattgcaatccactccagtattcttgcc 88705 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| | |||| ||||||||||||| | |||||| |||| || |||||| | Sbjct: 88706 tggagaatcccatgaacagaggagcctggcgggttgcagtccacagggctgcaaagagct 88765 Query: 467 gga 469 ||| Sbjct: 88766 gga 88768 Score = 67.9 bits (34), Expect = 6e-09 Identities = 101/123 (82%), Gaps = 4/123 (3%) Strand = Plus / Plus Query: 326 atgctggaaacccgggttcagtccctgggtggggaagatcccccggagaagggaatggct 385 |||| ||| |||| ||||| ||||||||| ||||||||||| |||||||| ||| Sbjct: 73730 atgcaggagacccaggttcgatccctgggtcaggaagatcccctggagaaggaaat---- 73785 Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 ||| |||||||||||| ||||| |||||| || |||||| |||||||| ||||||||| Sbjct: 73786 acctactccagtattcttgcctggagaatcccgtggacagaagagcctggtgggctacag 73845 Query: 446 tcc 448 ||| Sbjct: 73846 tcc 73848 Score = 63.9 bits (32), Expect = 9e-08 Identities = 96/116 (82%), Gaps = 1/116 (0%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| | |||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 13585 ggagaaggaagtggcaacccactccagtgttcttgcctggagaatcccagggac-gggga 13527 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| || |||| | | ||||| ||| || |||||||||||| Sbjct: 13526 gcctggtgggctgctgtctctggggtcgcacagagtcggacacgactgaagcgact 13471 Score = 61.9 bits (31), Expect = 3e-07 Identities = 40/43 (93%) Strand = Plus / Minus Query: 427 ggagcctggcgggctacagtccctagggttgaaaagagttgga 469 |||||||||||||||||||||| | |||||| ||||||||||| Sbjct: 82246 ggagcctggcgggctacagtccatggggttgcaaagagttgga 82204 Score = 61.9 bits (31), Expect = 3e-07 Identities = 76/91 (83%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| ||| |||| | || |||||||||||| |||| |||||| || Sbjct: 48729 ggaagatcccctggaggaggaaatgccaactgactccagtattcttgcccggagaattcc 48788 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | || ||| |||||||||| ||||||||||| Sbjct: 48789 atgggcagaggagcctggcaggctacagtcc 48819 Score = 60.0 bits (30), Expect = 1e-06 Identities = 48/54 (88%) Strand = Plus / Plus Query: 351 tgggtggggaagatcccccggagaagggaatggctacccactccagtattcatg 404 ||||| |||||||||||| |||| ||| |||||| ||| ||||||||||||||| Sbjct: 12606 tgggtcgggaagatcccctggagtaggaaatggcaaccaactccagtattcatg 12659 >gb|CM000206| Bos taurus chromosome X-FRAG[990000,1089999] Length = 100000 Score = 196 bits (99), Expect = 9e-48 Identities = 138/151 (91%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||| |||||| ||||||||| |||||||| Sbjct: 47069 atggtaaagaatctgcctgcaatgcaggagacccaggttcaatccctgggtcgggaagat 47128 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 47129 cccctggagaagggaatggcaacccactccagtattcttgcctggagaatcccatggaca 47188 Query: 425 ggggagcctggcgggctacagtccctagggt 455 ||||||||||| |||||||||||||| |||| Sbjct: 47189 ggggagcctggtgggctacagtccctggggt 47219 Score = 137 bits (69), Expect = 7e-30 Identities = 123/141 (87%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| ||| ||||||| | ||||||| |||| ||||| Sbjct: 49413 gtaaagaatctgcctgcaatgcaggagacctgggttcaattcctgggtcaggaaaatccc 49472 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| |||||||||||||||| ||||| |||||| | | |||||| | Sbjct: 49473 ctggagaaggaaatggcaacccactccagtattcttgcctggagaatccaatggacagag 49532 Query: 428 gagcctggcgggctacagtcc 448 |||||||| |||||||||||| Sbjct: 49533 gagcctggtgggctacagtcc 49553 Score = 131 bits (66), Expect = 4e-28 Identities = 105/118 (88%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| |||||||||||| |||||||| |||||| || ||||||||||| Sbjct: 3277 ggttcaatccctgggttgggaagatcccctggagaaggaaatggcaactcactccagtat 3336 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 ||||||||||||||| |||||||||| |||||||| ||| |||||||| | |||||| Sbjct: 3337 tcatgcctagagaattccacggacagaggagcctgatgggttacagtccatggggttg 3394 Score = 117 bits (59), Expect = 7e-24 Identities = 162/195 (83%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||||||||| | | |||| |||| |||||||| ||||||| Sbjct: 81852 atggtaaagaatctgcctgcaatgaagaagacccaggtttgacccctgggtcaggaagat 81911 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| |||||||||||||||| ||||| | ||| ||| || || Sbjct: 81912 cccctggagaagggaatggcaacccactccagtattcttgcctgggaaatcccatgggca 81971 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | |||||||||| ||||||||||| | |||| ||||||||||| || || | || ||| Sbjct: 81972 gaggagcctggcaggctacagtccatggggtcacaaagagttggacacgaccg-agtgac 82030 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 82031 taacactttcacttt 82045 Score = 101 bits (51), Expect = 4e-19 Identities = 103/119 (86%), Gaps = 1/119 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| ||||| |||||||||| |||| Sbjct: 66290 tccctgggttgggaagatcccctggaggagggcatggcaacccattccagtattcttgcc 66349 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 |||||||| ||| ||||| ||| |||||| ||||||||||| | |||||| ||||||| Sbjct: 66350 tagagaatccca-tgacagaggatcctggcaggctacagtccatggggttgcaaagagt 66407 Score = 101 bits (51), Expect = 4e-19 Identities = 111/131 (84%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||| |||| || |||||| |||||||| Sbjct: 95626 atggtaaagaatctgcctgcaatgcaggagacccaggtttgatctctgggtcgggaagat 95567 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||| | |||||| | |||||||||||||| ||||| | |||| ||| |||| Sbjct: 95566 cccctggagaaagaaatggcaatccactccagtattcttgcctggggaattccatggacc 95507 Query: 425 ggggagcctgg 435 | ||||||||| Sbjct: 95506 gaggagcctgg 95496 Score = 95.6 bits (48), Expect = 2e-17 Identities = 81/92 (88%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||||||| ||||||||||||||| ||||||| |||| Sbjct: 55059 gggttcaatccctgggttgggaagatcccctggagaagggaatggcaacccactgcagtg 55000 Query: 399 ttcatgcctagagaataccacggacaggggag 430 ||| ||||| |||||| ||| |||||| |||| Sbjct: 54999 ttcttgcctggagaattccatggacagaggag 54968 Score = 95.6 bits (48), Expect = 2e-17 Identities = 120/144 (83%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||||||| ||| ||| ||| ||| | ||||| Sbjct: 67320 atggtaaagaatctgcctgcaatgcgggaaacctgggatcaatcctgaggtcgaaaagat 67379 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||| ||||||| |||||||||||||||| ||| | ||| ||| ||||| Sbjct: 67380 cccctggagaagagaatggcaacccactccagtattctcacctgggaaatcccatggaca 67439 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||| | |||||||||||| Sbjct: 67440 gaggagccttgtgggctacagtcc 67463 Score = 91.7 bits (46), Expect = 4e-16 Identities = 88/102 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | |||||||||||| |||| |||| | || |||||||||||||||| |||| Sbjct: 80910 tccctggatcgggaagatcccctggaggagggcacagcaacccactccagtattcttgcc 80851 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| ||| || |||||||||||||||||||||| Sbjct: 80850 tggagaatcccatggatagaggagcctggcgggctacagtcc 80809 Score = 89.7 bits (45), Expect = 2e-15 Identities = 136/165 (82%), Gaps = 1/165 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| |||||| ||||||||| ||||| || Sbjct: 77617 tggtaaagaatccacctgcaatgtgggagacctgggttcgatccctgggttgggaatatg 77558 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaa-taccacggaca 424 ||| |||| |||| |||||||||||||||||||||| ||||| || || | ||| ||| | Sbjct: 77557 ccctggaggagggcatggctacccactccagtattcttgcctggataattcccatggaga 77498 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | | |||||||| ||||||||| | |||||| ||||||||||| Sbjct: 77497 gagaagcctggcaggctacagttcatagggtcacaaagagttgga 77453 Score = 87.7 bits (44), Expect = 6e-15 Identities = 98/116 (84%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 3795 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggaccgggga 3854 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| |||||| | |||| | | ||||| ||| || |||||||||||| Sbjct: 3855 gcctggtgggctgcagtccatggggtcgcacagagtcggacacgactgaagcgact 3910 Score = 83.8 bits (42), Expect = 9e-14 Identities = 87/102 (85%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| |||||||||||||||| |||| Sbjct: 18781 tccctgggtcaggaagatcccctggagaaggaaatggcaacccactccagtattcttgcc 18722 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| ||||| ||||||||| ||| |||||||| Sbjct: 18721 tgggaaatcccatagacagaggagcctggtgggttacagtcc 18680 Score = 83.8 bits (42), Expect = 9e-14 Identities = 78/90 (86%) Strand = Plus / Plus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||||||| |||||| | |||||||||||||| ||||| |||||| ||| Sbjct: 32860 gaagatcccctggagaaggaaatggcaatccactccagtattcttgcctggagaatccca 32919 Query: 419 cggacaggggagcctggcgggctacagtcc 448 |||||| ||||| |||| ||||| ||||| Sbjct: 32920 tggacagaggagcttggcaggctatagtcc 32949 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| || | |||||| | ||||||| ||||||||| Sbjct: 77736 tggtaaagaatctgcctgcaatgcaggagacaccggttcaattcctgggttgggaagatc 77677 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| | ||||||| || |||||||| |||||||| Sbjct: 77676 ccctcgggaagggataggttacccactgcagtattc 77641 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| |||| |||| | ||||||| ||||||| Sbjct: 71360 tggtaaagaatctgcctgcaatgcaggagaccccagttcgattcctgggtcaggaagatt 71419 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||||||| |||||||||||| ||||||| Sbjct: 71420 ccctggagaagggataggctacccactctagtattc 71455 Score = 79.8 bits (40), Expect = 1e-12 Identities = 109/132 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | |||||||||||| |||| | | |||| | |||||||||||||| | |||| Sbjct: 91466 tccctggattgggaagatcccctggaggatgaaatgacaacccactccagtatgcttgcc 91407 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | || ||| ||| |||||| ||||||||| ||||| |||||| | |||| | ||||||| Sbjct: 91406 tggaaaatcccatggacagaggagcctggagggctccagtccatggggtcgcaaagagtc 91347 Query: 467 ggatacaactga 478 ||||||||||| Sbjct: 91346 agatacaactga 91335 Score = 77.8 bits (39), Expect = 6e-12 Identities = 66/75 (88%) Strand = Plus / Plus Query: 391 ctccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtccct 450 ||||||||||| ||||| |||||| ||| |||||||||||||||| ||||||||||| | Sbjct: 54314 ctccagtattcttgcctggagaatcccatggacaggggagcctggtgggctacagtctat 54373 Query: 451 agggttgaaaagagt 465 |||||| ||||||| Sbjct: 54374 ggggttgcaaagagt 54388 Score = 77.8 bits (39), Expect = 6e-12 Identities = 51/55 (92%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||| |||||||||||| ||||||||||| ||||||||||| |||||||| Sbjct: 71520 tccctgggttgggaagatcccctggagaagggaaaggctacccacttcagtattc 71574 Score = 77.8 bits (39), Expect = 6e-12 Identities = 66/75 (88%) Strand = Plus / Minus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| |||||||| |||||| |||||||||||||||| ||||| ||||| ||| || Sbjct: 27234 gatcccctggagaaggaaatggcaacccactccagtattcttgcctgtagaatcccatgg 27175 Query: 422 acaggggagcctggc 436 |||| |||||||||| Sbjct: 27174 acagaggagcctggc 27160 Score = 77.8 bits (39), Expect = 6e-12 Identities = 102/123 (82%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||| | ||||||||| ||||| | |||||||||||||| |||| Sbjct: 84173 tccctgggtcaggaagatcctctggagaaggggatggcaatccactccagtattcttgcc 84232 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | || ||| ||| |||||| ||||||| |||||||||||| | | || | |||||||| Sbjct: 84233 tggaaaatcccatggacagaggagcctaatgggctacagtccatggtgtcgcaaagagtt 84292 Query: 467 gga 469 ||| Sbjct: 84293 gga 84295 Score = 75.8 bits (38), Expect = 2e-11 Identities = 86/102 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||||||| |||||| ||||||||||||| || |||| Sbjct: 3631 tccctgggtcgggaagatcccctggagaaggaaatggcaacccactccagtactcttgcc 3690 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | || || ||| |||| | ||||||||| |||| |||||| Sbjct: 3691 tggaaaaccccatggaccgaggagcctggtaggctgcagtcc 3732 Score = 73.8 bits (37), Expect = 9e-11 Identities = 97/117 (82%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| || ||||| ||| |||| | | |||||| | ||||| |||||| | ||||| Sbjct: 40288 cctgggttggaaagattccctggaggaagcaatggcaatccacttcagtatacttgcctg 40347 Query: 409 gagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 ||||| ||| |||||| ||| |||||||||||||||||| | |||||||||||||| Sbjct: 40348 aagaatcccatggacagaggaacctggcgggctacagtccatggggttgaaaagagt 40404 Score = 73.8 bits (37), Expect = 9e-11 Identities = 85/101 (84%) Strand = Plus / Plus Query: 335 acccgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactcc 394 |||| |||||| ||||||||| ||||||||| | |||| |||| ||||||||||| || Sbjct: 61218 acccaggttcaatccctgggtcaggaagatccactggaggagggcatggctacccatgcc 61277 Query: 395 agtattcatgcctagagaataccacggacaggggagcctgg 435 |||||| ||||| |||||| ||| |||||| ||||||||| Sbjct: 61278 agtatttttgcctggagaattccatggacagaggagcctgg 61318 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 89901 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 89960 Query: 430 gcctggcgggct 441 ||||| ||||| Sbjct: 89961 tcctggtgggct 89972 Score = 69.9 bits (35), Expect = 1e-09 Identities = 113/139 (81%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||| |||| |||||| ||||| |||| |||| ||||| ||||| |||||||||| ||| Sbjct: 87426 tccccgggttgggaaggtcccctggaggagggcatggcaacccattccagtattctagcc 87367 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | | ||| ||| || | ||||||||| |||||||||||| | || | | |||||||| Sbjct: 87366 tgaaaaatcccatgggtggaggagcctggtgggctacagtccatgggatcgcaaagagtt 87307 Query: 467 ggatacaactgaagcgact 485 ||| ||||||||||||||| Sbjct: 87306 ggacacaactgaagcgact 87288 Score = 60.0 bits (30), Expect = 1e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggc 384 |||||||||||||||||||||| |||||||| |||||| Sbjct: 17745 tccctgggtggggaagatcccctggagaaggaaatggc 17708 >gb|CM000182| Bos taurus chromosome 6-FRAG[42390000,42489999] Length = 100000 Score = 196 bits (99), Expect = 9e-48 Identities = 172/195 (88%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| |||||||||||| ||| ||| ||||||||||||| ||| |||||| | Sbjct: 54239 atggtaaagaatttgcctgcaatgcaggagacctgggttcagtccctaggttgggaaggt 54298 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||| ||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 54299 cccctggagaagggtatggcaacccactccagtattcttgcctggagaatcccatggaca 54358 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | ||| |||||||||||||||||||| |||| | ||||||||||| || |||| |||||| Sbjct: 54359 gaggaacctggcgggctacagtccctggggtcgcaaagagttggacacgactg-agcgac 54417 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 54418 tgacactttcacttt 54432 Score = 107 bits (54), Expect = 6e-21 Identities = 126/150 (84%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||||| |||| ||| |||||| ||| | ||||| |||| |||||||| Sbjct: 73176 gtaaagaatctgcctgcgatgcaggagacccggattcgattcctggatgggaaagatccc 73117 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 |||||||| |||||| |||||||||| ||||| ||| | |||||| ||| |||||| | Sbjct: 73116 ttggagaaggaaatggcaacccactccaatattcttgcttggagaatcccatggacagag 73057 Query: 428 gagcctggcgggctacagtccctagggttg 457 ||||||||| ||||| ||||| | |||||| Sbjct: 73056 gagcctggcaggctatagtccatggggttg 73027 Score = 99.6 bits (50), Expect = 2e-18 Identities = 89/102 (87%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| |||| Sbjct: 57350 tccctgggtcaggaagatcccctggagaagggaattgctacccactccagtattcttgcc 57291 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| | |||||| ||||||||| ||| |||||||| Sbjct: 57290 tggagaattctgtggacagaggagcctggtgggttacagtcc 57249 Score = 97.6 bits (49), Expect = 6e-18 Identities = 119/141 (84%), Gaps = 1/141 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| || ||||| ||| ||||| || |||||| Sbjct: 1483 atggtaaagaatctgcctgcagtgcaagagacccgagtttgagccctgagtcaggaagac 1542 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||||||||||| |||||||| ||||| |||||| ||| ||||| Sbjct: 1543 cccctggagaagggaatggctacccactgcagtattcttgcctggagaat-ccatggaca 1601 Query: 425 ggggagcctggcgggctacag 445 | |||||||| | |||||||| Sbjct: 1602 gaggagcctgacaggctacag 1622 Score = 91.7 bits (46), Expect = 4e-16 Identities = 139/170 (81%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||| |||||||| ||||| ||| ||| |||||| ||||||||| |||||||||||| Sbjct: 57908 taaagcatctgcctccaatgtgggagaccagggttcgatccctgggttgggaagatcccc 57849 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||||||| ||||| ||||||| ||||| || ||||| |||||| ||| |||| | | Sbjct: 57848 tggagaaggaaatggtaacccactacagtactcttgcctggagaatcccatggacggaga 57789 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 ||||||| || |||||||| | |||||| ||||||| ||| || ||||| Sbjct: 57788 agcctggtagggtacagtccatggggttgcaaagagtcggacacgactga 57739 Score = 85.7 bits (43), Expect = 2e-14 Identities = 101/119 (84%), Gaps = 1/119 (0%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| || |||||||| |||||||| |||||| | |||||||||||||| ||| Sbjct: 56524 tccctgggtcggaaagatccct-ggagaaggaaatggcaatccactccagtattcttgct 56466 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| ||| || ||||||||||||| |||||||||||| | ||| || ||||||| Sbjct: 56465 tggagaattccatgggcaggggagcctggtgggctacagtccattgggctgcaaagagt 56407 Score = 85.7 bits (43), Expect = 2e-14 Identities = 94/110 (85%), Gaps = 2/110 (1%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| ||| ||||| ||||||||| || ||||| Sbjct: 20442 atggtaaagaatctgcctgcagtgcgggagacctgggtttgatccctgggttggaaagat 20501 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||| ||||||||||| ||||||| ||||||||||| |||| |||||| Sbjct: 20502 cccctggagaagggaaaggctacc--ctccagtattctggcctggagaat 20549 Score = 85.7 bits (43), Expect = 2e-14 Identities = 58/63 (92%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||||||| ||||||||||| ||||||| ||||||||| Sbjct: 90252 gggttcaatccctgggttgggaagatcccctggagaagggaaaggctacctactccagta 90311 Query: 399 ttc 401 ||| Sbjct: 90312 ttc 90314 Score = 75.8 bits (38), Expect = 2e-11 Identities = 116/142 (81%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||| |||| || |||||| ||| ||| |||||| ||||||||| |||||||||| Sbjct: 22896 ggtaaagcgtctgtctccaatgcgggagacctgggttcgatccctgggttgggaagatcc 22837 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 | |||||||| |||||| ||||||||||||| || ||||| || ||| ||| ||||| Sbjct: 22836 tctggagaaggaaatggcaacccactccagtactcttgcctggaaaatcccatagacaga 22777 Query: 427 ggagcctggcgggctacagtcc 448 |||| ||| ||||||||||| Sbjct: 22776 ggagtgtggtaggctacagtcc 22755 Score = 75.8 bits (38), Expect = 2e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||| ||||| |||||||| |||||| |||||||||||||||| ||||| |||||| || Sbjct: 26329 ggaaggtcccctggagaaggaaatggcaacccactccagtattcttgcctggagaatccc 26388 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttg 467 | || ||| ||| ||| |||||||||||| | |||||| |||| |||| Sbjct: 26389 atgggcagaggacactgatgggctacagtccgtggggttgcaaagggttg 26438 Score = 75.8 bits (38), Expect = 2e-11 Identities = 93/110 (84%), Gaps = 1/110 (0%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| ||||||| |||| ||||||| ||| || ||||||||||||| Sbjct: 33462 gggttcaatccctgggttgggaagagcccctagagaaggaaattgcaacccactccagta 33521 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| |||| |||| | |||||||||| |||||||| ||||||||||| Sbjct: 33522 ttctggcctggagact-ccacggacagaacagcctggcaggctacagtcc 33570 Score = 73.8 bits (37), Expect = 9e-11 Identities = 130/161 (80%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||||||||| || ||| | | ||||||| ||| ||||| ||||||| Sbjct: 32755 atggtaaagagtctgcctgcattgtgggagatctgggttcaatccttgggtcaggaagat 32814 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || ||||||||||||||| ||||| |||| ||||| ||||| || ||| ||| || Sbjct: 32815 ctcctggagaagggaatggcaacccattccaatattcttgcctggaaaattccatggctg 32874 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||||||| ||||||||||||| | ||||| ||||||| Sbjct: 32875 gaggagcctcacgggctacagtccatgtggttgcaaagagt 32915 Score = 73.8 bits (37), Expect = 9e-11 Identities = 130/161 (80%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 |||||||||||| ||||||| ||| | || |||| ||||||||| || |||||||| Sbjct: 4838 taaagaatctgcttgcaatgaaggagatgtggattcaatccctgggtcagggagatcccc 4897 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||||||||| |||||||||||| || ||||||| ||| ||| | |||||| Sbjct: 4898 tggagaagggaatggcagcccactccagtactcttgcctaggaaatcccatgaacaggga 4957 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttgga 469 || ||||| |||||||||| ||| | | ||||||||||| Sbjct: 4958 agtctggccagctacagtccatagcatcgcaaagagttgga 4998 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 5929 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 5988 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 5989 gcctggtgggct 6000 Score = 67.9 bits (34), Expect = 6e-09 Identities = 70/82 (85%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||| || |||| |||| ||||| |||||||||||||||| ||||| Sbjct: 19138 cctgggtctggaagatctcctggaggagggcatggcaacccactccagtattcttgcctg 19197 Query: 409 gagaataccacggacaggggag 430 ||||| |||||||||| |||| Sbjct: 19198 gagaagcccacggacagaggag 19219 Score = 65.9 bits (33), Expect = 2e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 79801 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 79742 Query: 430 gcctg 434 ||||| Sbjct: 79741 gcctg 79737 Score = 63.9 bits (32), Expect = 9e-08 Identities = 77/92 (83%) Strand = Plus / Plus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||| ||||||||| ||| |||| ||||| | | ||||| ||||||||||| Sbjct: 90104 aaagaatctgtctgcaatgcaggagaccccagttcaattcttgggtcaggaagatcccct 90163 Query: 370 ggagaagggaatggctacccactccagtattc 401 |||||||||| | ||| |||||||||||||| Sbjct: 90164 ggagaagggatagactagccactccagtattc 90195 Score = 63.9 bits (32), Expect = 9e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 65316 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 65375 Query: 430 gcct 433 |||| Sbjct: 65376 gcct 65379 Score = 63.9 bits (32), Expect = 9e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 62093 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 62152 Query: 430 gcct 433 |||| Sbjct: 62153 gcct 62156 >gb|CM000180| Bos taurus chromosome 4-FRAG[19260000,19359999] Length = 100000 Score = 196 bits (99), Expect = 9e-48 Identities = 172/195 (88%), Gaps = 1/195 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 78697 atggtaaagaatctgcctgcaatgcaggagacctgggttctatccctgggtcgggaagat 78638 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||| | |||||||||||||||| ||||| |||||| ||||||||| Sbjct: 78637 cccctggagaaggaaatgccaacccactccagtattcttgcctggagaatcccacggaca 78578 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | | ||||||| ||||| ||||| |||||||| ||||||||||| ||||||| |||||| Sbjct: 78577 gagcagcctggtaggctatagtccatagggttgcaaagagttggacacaactg-agcgac 78519 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 78518 taacactttcacttt 78504 Score = 109 bits (55), Expect = 2e-21 Identities = 121/143 (84%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||| ||| ||| ||| || ||| | | ||||| ||||||||||| Sbjct: 97377 gtaaagaatctgcctgcagtgcaggagacctggattcgattcttgggttgggaagatccc 97436 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| | |||| |||||||||||||||| || || |||||| ||| |||||| | Sbjct: 97437 ctggagaaggaagtggcaacccactccagtattcttgactggagaatcccatggacagag 97496 Query: 428 gagcctggcgggctacagtccct 450 |||||||| ||| |||||||||| Sbjct: 97497 gagcctggaggggtacagtccct 97519 Score = 99.6 bits (50), Expect = 2e-18 Identities = 96/110 (87%), Gaps = 1/110 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||||||| |||| | ||| ||||||||| |||||||| Sbjct: 64507 atggtaaagaatctgcctgcagtgctggagacccagattcgatccctgggttgggaagat 64566 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||| |||| |||| ||||| | |||||||||||||| ||||| |||||| Sbjct: 64567 cccctggaggagggcatggc-aaccactccagtattcttgcctggagaat 64615 Score = 91.7 bits (46), Expect = 4e-16 Identities = 119/142 (83%), Gaps = 1/142 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||| |||| |||| | |||||||| ||||| |||| Sbjct: 29003 tccctgggtcaggaagatccccaggaggagggtatgggaatccactccaatattcttgcc 29062 Query: 407 tagagaatacc-acggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| || | |||||| ||||||||||||||| |||| | |||||| ||||||| Sbjct: 29063 tggagaatccccatggacagaggagcctggcgggctgcagtgcatagggtcataaagagt 29122 Query: 466 tggatacaactgaagcgactca 487 |||| ||||||||||| ||||| Sbjct: 29123 tggacacaactgaagcaactca 29144 Score = 87.7 bits (44), Expect = 6e-15 Identities = 84/96 (87%), Gaps = 1/96 (1%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||| |||||||||||| ||| ||| | ||||| ||||| | | ||||||||| Sbjct: 7543 tggtaaagaatttgcctgcaatgcaggagacctgagttcaatccctagtttgggaagatc 7602 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||||| ||||||||| |||||||||| Sbjct: 7603 cccaggagaagggaaaggctaccca-tccagtattc 7637 Score = 83.8 bits (42), Expect = 9e-14 Identities = 69/78 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||||||||||| |||||||||||||||| |||||||| ||| ||| |||||| | | Sbjct: 22416 ggagaagggaatggcaacccactccagtattcttgcctagaaaattccatggacagagca 22357 Query: 430 gcctggcgggctacagtc 447 |||||| ||||| ||||| Sbjct: 22356 gcctggagggctgcagtc 22339 Score = 81.8 bits (41), Expect = 4e-13 Identities = 126/153 (82%), Gaps = 1/153 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||| ||||||||||||||||| | ||| |||| | |||| ||||||||| |||| || Sbjct: 67632 atggtgaagaatctgcctgcaatacaggagacccag-ttcaatccctgggtcaggaaaat 67690 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| | |||| ||||||||| ||||| ||||| |||||| || |||| Sbjct: 67691 cccctggagaaggaagtggcagcccactccaatattcttgcctggagaatttcatggact 67750 Query: 425 ggggagcctggcgggctacagtccctagggttg 457 | ||||||| | ||||||||||| |||||||| Sbjct: 67751 gaggagcctagtaggctacagtccatagggttg 67783 Score = 79.8 bits (40), Expect = 1e-12 Identities = 110/132 (83%), Gaps = 1/132 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctg-gaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||| |||||||| | || ||| ||||| ||||||||| |||||| Sbjct: 36222 tggtaaagaatctgtctgcaatgaagagagacctgggtttgatccctgggtcaagaagat 36281 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||| |||| ||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 36282 cccctggaaaaggaaatgggaacccactccagtattcttgcctggagaattccatggaca 36341 Query: 425 ggggagcctggc 436 | |||||||||| Sbjct: 36342 gaggagcctggc 36353 Score = 75.8 bits (38), Expect = 2e-11 Identities = 68/78 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| ||| |||||| |||||||||||||||| ||||| |||||| ||| ||| || ||| Sbjct: 22314 ggaggaggaaatggcaacccactccagtattcttgcctggagaatcccatggatagagga 22255 Query: 430 gcctggcgggctacagtc 447 ||||||| |||||||||| Sbjct: 22254 gcctggcaggctacagtc 22237 Score = 67.9 bits (34), Expect = 6e-09 Identities = 61/70 (87%) Strand = Plus / Plus Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 |||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||| ||||||| Sbjct: 38979 aaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagaggagcct 39038 Query: 434 ggcgggctac 443 || ||||||| Sbjct: 39039 ggtgggctac 39048 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||| ||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 79835 ggagaaggaaatggcaacccactctagtgttcttgcctggagaatcccagggacggggga 79776 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 79775 gcctggtgggct 79764 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||| | || Sbjct: 99800 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacggcaga 99859 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 99860 gcctggtgggct 99871 Score = 61.9 bits (31), Expect = 3e-07 Identities = 61/71 (85%) Strand = Plus / Minus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||| |||||| |||||||||||| || ||||| |||||| ||| |||| ||||||| Sbjct: 32225 agaaggaaatggcaacccactccagtgctcttgcctggagaatcccagggacgggggagc 32166 Query: 432 ctggcgggcta 442 |||| |||||| Sbjct: 32165 ctggtgggcta 32155 >gb|CM000177| Bos taurus chromosome 1-FRAG[99180000,99279999] Length = 100000 Score = 194 bits (98), Expect = 4e-47 Identities = 155/174 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| ||||||| ||||||||| |||||||| Sbjct: 8766 atggtaaagaatctgcctgcaatgcaggagaccagggttcaatccctgggtcgggaagat 8707 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| | ||||||||||||| ||||| |||||| ||| ||||| Sbjct: 8706 cccctggagaagggaatggcaatgcactccagtattcttgcctggagaattccatggaca 8647 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||||||||||||||||||||| | |||| | ||||||| ||||||||||| Sbjct: 8646 ggggagcctggcgggctacagtccatggggtcgcaaagagtcagatacaactga 8593 Score = 107 bits (54), Expect = 6e-21 Identities = 96/110 (87%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| || ||| ||||||| | ||| ||| |||||||| Sbjct: 78960 atggtaaagaatctgcctgcaatgcaagagacctgggttcaatgcctaggttgggaagat 79019 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||| |||| |||| ||||| |||||||||||||||| ||||| |||||| Sbjct: 79020 cccctggaggagggtatggcaacccactccagtattcttgcctggagaat 79069 Score = 103 bits (52), Expect = 1e-19 Identities = 85/96 (88%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||| ||||||||||||||||| | ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 82228 tggtcaagaatctgcctgcaatacaggagacctgggttcaatccctgggttgggaagatc 82169 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||||| ||||||||||||| ||||| Sbjct: 82168 ccctggagaagggaacagctacccactccactattc 82133 Score = 103 bits (52), Expect = 1e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 314 aatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggag 373 |||||||||||||||| ||| |||| |||| ||||||||| |||||||||| |||| Sbjct: 1075 aatctgcctgcaatgcaggagacccatattcaatccctgggtccagaagatcccctggag 1016 Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 |||| |||||| |||||||||||||||| ||||| | || ||| |||||| ||||||| Sbjct: 1015 aaggaaatggcaacccactccagtattcttgcctgggaaaccccatggacagaggagcct 956 Query: 434 ggcgggctacagtccctagggttgaaaagagttgga 469 ||| ||||| ||||| |||||| | ||||| ||||| Sbjct: 955 ggcaggctatagtccatagggtcgcaaagaattgga 920 Score = 97.6 bits (49), Expect = 6e-18 Identities = 94/109 (86%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||||| |||||||| ||||||||||| ||||||||||| |||| |||||| | Sbjct: 80021 gggaagatcccctggagaaggtaatggctacccgctccagtattctggcctggagaattc 79962 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 || |||||| ||| | |||| ||||||||||| | |||||| ||||||| Sbjct: 79961 catggacagaggaacatggcaggctacagtccatggggttgcaaagagt 79913 Score = 97.6 bits (49), Expect = 6e-18 Identities = 123/145 (84%), Gaps = 2/145 (1%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaa-acccgggttcagtccctgggtggggaaga 363 |||||||||||||||||||||| | ||||| | || |||| || |||||| ||||||| Sbjct: 4193 atggtaaagaatctgcctgcaagg-tggaagatccaggtttgatctctgggtcgggaaga 4251 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| ||||||||| ||||| |||||||||||||||| ||||| || ||| ||| |||| Sbjct: 4252 tcccctggagaagggcatggcaacccactccagtattcttgcctggaaaattccatggac 4311 Query: 424 aggggagcctggcgggctacagtcc 448 || ||||||||| | |||| ||||| Sbjct: 4312 agaggagcctggggagctatagtcc 4336 Score = 95.6 bits (48), Expect = 2e-17 Identities = 84/96 (87%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||||||| |||||||||||||||||| |||| |||| ||||| |||||||||||||| Sbjct: 97511 ggttcagtccttgggtggggaagatcccctggaggagggcatggcaacccactccagtat 97452 Query: 400 tcatgcctagagaataccacggacaggggagcctgg 435 || ||||| |||||| ||| ||||| |||| |||| Sbjct: 97451 tcttgcctggagaatcccatagacagaggagtctgg 97416 Score = 95.6 bits (48), Expect = 2e-17 Identities = 114/136 (83%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||| || | | |||| |||||||||||||||| ||||||||| || Sbjct: 87715 taaagaatctgcctgcagcgcagaagacccaggttcagtccctgggtcgggaagatctcc 87656 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||||||| | ||||||| |||||||| || || || ||| ||| |||||| || Sbjct: 87655 tggagaagggaatgacaacccacttcagtattcttgtctggaaaatcccatggacagagg 87596 Query: 429 agcctggcgggctaca 444 | ||||| || ||||| Sbjct: 87595 aacctggaggactaca 87580 Score = 95.6 bits (48), Expect = 2e-17 Identities = 120/144 (83%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| ||||| ||| ||| | ||| ||||||||| |||||| Sbjct: 70880 atggtaaagaatctgcctgtaatgcaggagacctgagtttgatccctgggtcaagaagat 70821 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 || ||| ||||||||||| ||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 70820 gccttggaaaagggaatggcaacccactccagtatttttgcctggagaatcccatggaca 70761 Query: 425 ggggagcctggcgggctacagtcc 448 | ||| ||||| |||||||||||| Sbjct: 70760 gaggaacctggagggctacagtcc 70737 Score = 91.7 bits (46), Expect = 4e-16 Identities = 100/118 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| ||| |||||| ||| || || ||| ||||| Sbjct: 73262 tggtaaagaatctgcctgcaatgcgggagacctgggttcgatccttgtgttgggtagatc 73321 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || |||||| |||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 73322 ccttggagaaaggaaaggctacccactccagtattctggcctggagaattccatggac 73379 Score = 87.7 bits (44), Expect = 6e-15 Identities = 90/104 (86%), Gaps = 1/104 (0%) Strand = Plus / Minus Query: 345 agtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatg 404 ||||||||||| |||||||||||| |||| ||| |||||| |||||||||||||||| || Sbjct: 85626 agtccctgggttgggaagatcccctggaggaggaaatggcaacccactccagtattcttg 85567 Query: 405 cctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| || ||| | | |||||| ||||||| | |||||||||||| Sbjct: 85566 cctggaaaattctatggacagaggagcct-gtgggctacagtcc 85524 Score = 83.8 bits (42), Expect = 9e-14 Identities = 87/102 (85%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||| ||||| ||||||| |||||| ||||| |||||||||| |||| Sbjct: 43478 tccctgggtcaggaaggtcccctagagaaggaaatggcaacccattccagtattcttgcc 43419 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||||| ||| ||||| |||||||||||| Sbjct: 43418 tggagaatcccatggacagaggaacctggtgggctacagtcc 43377 Score = 81.8 bits (41), Expect = 4e-13 Identities = 98/117 (83%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||| || || ||||| ||| |||| |||| ||||| ||||||||||||| Sbjct: 2422 gggttcaaaccctgagttggaaagattccctggaggagggcatggcaacccactccagta 2481 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 ||| ||||| |||||| ||| |||||| ||||||||| | | |||||||| |||||| Sbjct: 2482 ttcttgcctggagaattccatggacagaggagcctggtgtgatacagtccatagggt 2538 Score = 81.8 bits (41), Expect = 4e-13 Identities = 116/141 (82%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||| ||||||| ||| | | |||| ||||||||| |||||||| || Sbjct: 88317 gtaaagaatctgccagcaatgcaggagatctaggtttgatccctgggttgggaagatacc 88376 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||| || ||||| ||| ||||||| |||| ||||| |||||| ||| || ||| | Sbjct: 88377 ctggaggagaagatggcaacctactccagaattcttgcctggagaattccatgggcagag 88436 Query: 428 gagcctggcgggctacagtcc 448 ||||||||||||||||||||| Sbjct: 88437 gagcctggcgggctacagtcc 88457 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 11512 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggactgggga 11453 Query: 430 gcctggcgggct 441 |||||||||||| Sbjct: 11452 gcctggcgggct 11441 Score = 77.8 bits (39), Expect = 6e-12 Identities = 118/143 (82%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| || |||||| |||||||||||| |||| |||| | | ||||| ||||||| Sbjct: 40432 gggttcaatctctgggttgggaagatcccctggaggagggcacaga-acccattccagta 40374 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 ||||||||| |||||| || |||||| |||||||| | |||||| |||| | |||||| Sbjct: 40373 ttcatgcctggagaatcccctggacagaggagcctgacaggctacggtccattgggttgc 40314 Query: 459 aaagagttggatacaactgaagc 481 ||||||| ||| || |||||||| Sbjct: 40313 aaagagtcggacacgactgaagc 40291 Score = 77.8 bits (39), Expect = 6e-12 Identities = 151/187 (80%), Gaps = 1/187 (0%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||| ||| ||| |||||| ||||||||| ||||||||||| Sbjct: 41601 gtaaagaatctgcctgcaatcagggagacctgggttcgatccctgggtcgggaagatccc 41660 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||| || ||||| ||| || |||||| | ||||| |||||| ||| |||||| | Sbjct: 41661 ctggaggagaacatggcaacctgcttcagtatccttgcctggagaatcccatggacagag 41720 Query: 428 gagcctggcgggctacagtccctagggttg-aaaagagttggatacaactgaagcgactc 486 |||||||| | |||| || || | |||| | |||| ||| ||| ||||||||||| ||| Sbjct: 41721 gagcctggtgtgctaaagcccttggggtggcaaaaaagtaggacacaactgaagcaacta 41780 Query: 487 acacttt 493 ||||||| Sbjct: 41781 acacttt 41787 Score = 71.9 bits (36), Expect = 4e-10 Identities = 88/104 (84%), Gaps = 1/104 (0%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 |||| |||||||||||| ||||||||||| |||| |||| ||||| || ||| ||||| Sbjct: 75447 gggtccagtccctgggtcaggaagatcccctggaggagggcatggcaactcac-acagta 75505 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggcta 442 ||| ||||| |||||| ||| |||||| ||||||||| |||||| Sbjct: 75506 ttcttgcctggagaatcccatggacagaggagcctggtgggcta 75549 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 5800 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 5741 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 5740 gcctggtgggct 5729 Score = 69.9 bits (35), Expect = 1e-09 Identities = 86/103 (83%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| | ||||||| ||||||||||| |||||||| |||||| ||||||| ||||| Sbjct: 64143 gggttcaattcctgggtaaggaagatcccctggagaaggaaatggcaacccactacagta 64202 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggct 441 ||| ||||| || ||| ||| |||| | |||| |||| ||||| Sbjct: 64203 ttcttgcctggaaaatcccatggactgaggagtctggtgggct 64245 Score = 67.9 bits (34), Expect = 6e-09 Identities = 76/89 (85%), Gaps = 2/89 (2%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||| || ||||| ||| ||||||||||||||||| |||||| || Sbjct: 26466 ggaagatcccctggagaaaggcatggcaaccttctccagtattcatgcctggagaatccc 26407 Query: 418 acggacagggg--agcctggcgggctaca 444 | |||||| || ||||||| |||||||| Sbjct: 26406 aaggacagaggctagcctggtgggctaca 26378 Score = 67.9 bits (34), Expect = 6e-09 Identities = 46/50 (92%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccag 396 ||||||||| ||||||| ||| ||||||||||||||||||||||||||| Sbjct: 49088 tccctgggtcaggaagattccctggagaagggaatggctacccactccag 49039 Score = 65.9 bits (33), Expect = 2e-08 Identities = 61/69 (88%), Gaps = 1/69 (1%) Strand = Plus / Plus Query: 347 tccctgggtggggaaga-tcccccggagaagggaatggctacccactccagtattcatgc 405 ||||||||| ||||||| ||||| |||| ||| |||||| |||||||||||||||| ||| Sbjct: 90118 tccctgggttgggaagactcccctggaggaggaaatggcaacccactccagtattcttgc 90177 Query: 406 ctagagaat 414 || |||||| Sbjct: 90178 ctggagaat 90186 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| | |||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 43758 ggagaaggaaatggcaagccactccagtgttcttgcctggagaatcccagggacggggga 43699 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 43698 gcctggtgggct 43687 Score = 63.9 bits (32), Expect = 9e-08 Identities = 53/60 (88%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||| ||| |||| ||| |||||| ||||||||||||| Sbjct: 9861 gggttcaatccctgggttgggaagatgccctggagcaggcaatggcaacccactccagta 9802 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||| ||| Sbjct: 6210 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacgacgga 6151 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 6150 gcctggtgggct 6139 Score = 63.9 bits (32), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 ||||||||||| |||| |||| ||||| | |||||||||||||| || || |||||| | Sbjct: 18651 gggaagatcccttggaggagggcatggcaatccactccagtattcttgtctggagaatcc 18592 Query: 417 cacggacaggggagcctggc 436 || |||||| |||||||||| Sbjct: 18591 catggacagaggagcctggc 18572 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| | |||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 46763 ggagaaggaaatggcaagccactccagtgttcttgcctggagaatcccagggacggggga 46822 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 46823 gcctggtgggct 46834 Score = 61.9 bits (31), Expect = 3e-07 Identities = 88/107 (82%) Strand = Plus / Plus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||||||||| || Sbjct: 87403 aatggcaacccactccagtgttcttgcctggagaatcccagggatgggggagcctggtgg 87462 Query: 439 gctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 ||| | ||| | |||| | | ||||||||| || |||||||||||| Sbjct: 87463 gctgccgtctatggggtcgcacagagttggacacgactgaagcgact 87509 Score = 60.0 bits (30), Expect = 1e-06 Identities = 60/70 (85%) Strand = Plus / Minus Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| |||||||||||||| ||||| |||||| ||| ||||| Sbjct: 47938 cccctggagaaggaaatggcaacccactccagtatctttgcctggagaatcccatggaca 47879 Query: 425 ggggagcctg 434 | |||||||| Sbjct: 47878 gaggagcctg 47869 Score = 58.0 bits (29), Expect = 5e-06 Identities = 60/69 (86%), Gaps = 1/69 (1%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatccccc-ggagaagggaatggctacccactccagta 398 |||||| ||||||||| || |||| |||| |||||||| |||||| |||||||||| || Sbjct: 59986 ggttcaatccctgggttggagagattcccctggagaaggaaatggcaacccactccaata 60045 Query: 399 ttcatgcct 407 ||||||||| Sbjct: 60046 ttcatgcct 60054 >gb|CM000177| Bos taurus chromosome 1-FRAG[99090000,99189999] Length = 100000 Score = 194 bits (98), Expect = 4e-47 Identities = 155/174 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| ||||||| ||||||||| |||||||| Sbjct: 98766 atggtaaagaatctgcctgcaatgcaggagaccagggttcaatccctgggtcgggaagat 98707 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| | ||||||||||||| ||||| |||||| ||| ||||| Sbjct: 98706 cccctggagaagggaatggcaatgcactccagtattcttgcctggagaattccatggaca 98647 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||||||||||||||||||||| | |||| | ||||||| ||||||||||| Sbjct: 98646 ggggagcctggcgggctacagtccatggggtcgcaaagagtcagatacaactga 98593 Score = 159 bits (80), Expect = 2e-36 Identities = 169/196 (86%), Gaps = 2/196 (1%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||||||||| ||| |||| |||| |||||||| |||||||| Sbjct: 70421 atggtaaagaatctgcctgcaatggaggagacccaggttttacccctgggttgggaagat 70480 Query: 365 ccccc-ggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| |||||||||||||||||||||||||||||||| ||||| | |||| || |||| Sbjct: 70481 ccccccggagaagggaatggctacccactccagtattcttgcctggcgaatcccttggac 70540 Query: 424 aggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcga 483 || ||||||||| |||||||||||| | |||| | ||||||||| | || |||| ||||| Sbjct: 70541 agaggagcctggtgggctacagtccatggggtcgcaaagagttgaacacgactg-agcga 70599 Query: 484 ctcacactttcacttt 499 || ||||||||||||| Sbjct: 70600 ctaacactttcacttt 70615 Score = 115 bits (58), Expect = 3e-23 Identities = 118/138 (85%) Strand = Plus / Plus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 ||||||||| ||||||| ||| |||| |||| ||||| ||||||||| |||| ||||| Sbjct: 57338 ccctgggtgaggaagatgccctggaggagggcatggcagtccactccagcattcttgcct 57397 Query: 408 agagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttg 467 |||||| ||| |||||| |||||||||||||||||||||| | |||||| ||||||||| Sbjct: 57398 ggagaatcccatggacagaggagcctggcgggctacagtccatggggttgcaaagagttg 57457 Query: 468 gatacaactgaagcgact 485 || | |||||||||||| Sbjct: 57458 gacatgactgaagcgact 57475 Score = 103 bits (52), Expect = 1e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 314 aatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggag 373 |||||||||||||||| ||| |||| |||| ||||||||| |||||||||| |||| Sbjct: 91075 aatctgcctgcaatgcaggagacccatattcaatccctgggtccagaagatcccctggag 91016 Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 |||| |||||| |||||||||||||||| ||||| | || ||| |||||| ||||||| Sbjct: 91015 aaggaaatggcaacccactccagtattcttgcctgggaaaccccatggacagaggagcct 90956 Query: 434 ggcgggctacagtccctagggttgaaaagagttgga 469 ||| ||||| ||||| |||||| | ||||| ||||| Sbjct: 90955 ggcaggctatagtccatagggtcgcaaagaattgga 90920 Score = 97.6 bits (49), Expect = 6e-18 Identities = 123/145 (84%), Gaps = 2/145 (1%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaa-acccgggttcagtccctgggtggggaaga 363 |||||||||||||||||||||| | ||||| | || |||| || |||||| ||||||| Sbjct: 94193 atggtaaagaatctgcctgcaagg-tggaagatccaggtttgatctctgggtcgggaaga 94251 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| ||||||||| ||||| |||||||||||||||| ||||| || ||| ||| |||| Sbjct: 94252 tcccctggagaagggcatggcaacccactccagtattcttgcctggaaaattccatggac 94311 Query: 424 aggggagcctggcgggctacagtcc 448 || ||||||||| | |||| ||||| Sbjct: 94312 agaggagcctggggagctatagtcc 94336 Score = 91.7 bits (46), Expect = 4e-16 Identities = 119/142 (83%), Gaps = 1/142 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||| |||||||||||| ||| ||| |||||| |||||||| |||||||| Sbjct: 84377 atggtaaagaagctgcctgcaatgtgggagacctgggttcgagccctgggttgggaagat 84318 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaatac-cacggac 423 |||| |||| ||| ||||| |||||||| ||||| | ||||| |||||| | || |||| Sbjct: 84317 cccctggaggaggacatggcaacccactctagtatgcttgcctggagaatcctcatggac 84258 Query: 424 aggggagcctggcgggctacag 445 || |||||||||| |||||||| Sbjct: 84257 agaggagcctggcaggctacag 84236 Score = 89.7 bits (45), Expect = 2e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| |||||| ||| ||| ||| | ||||| ||||||||| ||||| |||| Sbjct: 2883 ggtaaagaatccacctgcagtgcgggagacctgagttcaatccctgggttgggaaaatcc 2824 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || | ||||||||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 2823 cctgaagaagggaaaggctacccactccagtattctggcctggagaattccatggac 2767 Score = 85.7 bits (43), Expect = 2e-14 Identities = 76/87 (87%) Strand = Plus / Plus Query: 315 atctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggaga 374 |||||||| ||||| ||||||||||||||| ||||||||| |||||||| || ||||| Sbjct: 7277 atctgcctacaatgagggaaacccgggttcaatccctgggtcaggaagatctcctggaga 7336 Query: 375 agggaatggctacccactccagtattc 401 ||| |||||| | |||||||||||||| Sbjct: 7337 aggaaatggcaatccactccagtattc 7363 Score = 81.8 bits (41), Expect = 4e-13 Identities = 98/117 (83%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||| || || ||||| ||| |||| |||| ||||| ||||||||||||| Sbjct: 92422 gggttcaaaccctgagttggaaagattccctggaggagggcatggcaacccactccagta 92481 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 ||| ||||| |||||| ||| |||||| ||||||||| | | |||||||| |||||| Sbjct: 92482 ttcttgcctggagaattccatggacagaggagcctggtgtgatacagtccatagggt 92538 Score = 71.9 bits (36), Expect = 4e-10 Identities = 99/120 (82%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||| ||||||||||| || | | ||||| ||||| ||| ||||||||| Sbjct: 80336 tggtaaagaatttgcctgcaatgtgagagagctgggtttgatccctcggttgggaagatc 80395 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 || |||||||||| ||||||||||| |||||||| |||| |||||| |||||||||| Sbjct: 80396 acctagagaagggaaaggctacccactacagtattctggcctggagaattccacggacag 80455 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 95800 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 95741 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 95740 gcctggtgggct 95729 Score = 71.9 bits (36), Expect = 4e-10 Identities = 60/68 (88%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||||| ||||||| |||||||||||| |||| ||| |||||| |||| ||||||||| Sbjct: 44469 ggttcagtacctgggttgggaagatcccctggaggaggaaatggcaaccctctccagtat 44528 Query: 400 tcatgcct 407 || ||||| Sbjct: 44529 tcttgcct 44536 Score = 67.9 bits (34), Expect = 6e-09 Identities = 55/62 (88%) Strand = Plus / Minus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| |||||||||||||||| |||| ||||||| ||| |||||| ||||||||| || Sbjct: 63537 aatggcaacccactccagtattcctgcccagagaatcccatggacagaggagcctggtgg 63478 Query: 439 gc 440 || Sbjct: 63477 gc 63476 Score = 63.9 bits (32), Expect = 9e-08 Identities = 80/96 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||| ||||||||| ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 80217 tggtaaagaattcacctgcaatgtgggagacctgggttcaatccctgggttgggaagatc 80276 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | | |||| |||| ||||| ||||||||||||| Sbjct: 80277 ctctgaagaaaggaaaggctattcactccagtattc 80312 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||| ||| Sbjct: 96210 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacgacgga 96151 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 96150 gcctggtgggct 96139 Score = 63.9 bits (32), Expect = 9e-08 Identities = 53/60 (88%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||| ||| |||| ||| |||||| ||||||||||||| Sbjct: 99861 gggttcaatccctgggttgggaagatgccctggagcaggcaatggcaacccactccagta 99802 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| | |||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 82145 ggagaaggaaatggcaagccactccagtgttcttgcctggagaatcccagggacggggga 82086 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 82085 gcctggtgggct 82074 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| ||||| ||| |||| ||||| Sbjct: 34326 ggagaaggaaatggcaacccactccagtgttcttgcctggagaaccccagggacggggga 34267 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 34266 gcctggtgggct 34255 >gb|CM000178| Bos taurus chromosome 2-FRAG[67140000,67239999] Length = 100000 Score = 192 bits (97), Expect = 1e-46 Identities = 130/141 (92%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||| || Sbjct: 52647 ggtaaagaatctgcctgcaatgcaggaaacccgggttcaatccctgggttgggaagaccc 52588 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||||||||||||||||||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 52587 cctggagaagggaatggctacccactccagtattcttgcctggagaatcccatggacaga 52528 Query: 427 ggagcctggcgggctacagtc 447 |||||||||| |||||||||| Sbjct: 52527 ggagcctggcaggctacagtc 52507 Score = 101 bits (51), Expect = 4e-19 Identities = 129/155 (83%) Strand = Plus / Minus Query: 324 caatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaagggaatgg 383 |||||| ||| ||| ||||||| ||||||||| |||||||||||| |||||||| ||||| Sbjct: 31005 caatgcgggagacctgggttcaatccctgggttgggaagatcccctggagaaggaaatgg 30946 Query: 384 ctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctac 443 | ||||| ||||||| | ||| | || ||| |||||||||| ||||||||| |||||| Sbjct: 30945 caacccattccagtacccttgcttggaaaatcccacggacagaggagcctggtaggctac 30886 Query: 444 agtccctagggttgaaaagagttggatacaactga 478 | ||| ||||| ||||||||| || |||||||| Sbjct: 30885 aatccacagggtcgaaaagagtcagacacaactga 30851 Score = 91.7 bits (46), Expect = 4e-16 Identities = 91/106 (85%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||||||| |||||||| |||||| ||| ||||||||| Sbjct: 58602 gggttcaatccctgggtcgggaagatcccctggagaaggaaatggcaacctactccagta 58543 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctaca 444 || || || | ||| ||| |||||| |||||||||||||||||| Sbjct: 58542 ctcttgactgggaaatcccatggacagaggagcctggcgggctaca 58497 Score = 91.7 bits (46), Expect = 4e-16 Identities = 92/106 (86%), Gaps = 1/106 (0%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| ||| || |||| |||||| | ||||| ||||| Sbjct: 89876 gtaaagaatctgcctgcaatgcgggagacctgg-ttcaatccctgatttgggaatatccc 89818 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaa 413 | ||||||||||| |||||||||||| ||||||| |||||||||| Sbjct: 89817 ctggagaagggaaaggctacccactctagtattctggcctagagaa 89772 Score = 87.7 bits (44), Expect = 6e-15 Identities = 98/116 (84%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||| ||||| Sbjct: 95532 ggagaaggcaatggcaacccactccagtattcttgcctggagaatcccagggacggggga 95591 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||| | | ||||| ||| ||||||||||||||| Sbjct: 95592 gcctggtgggctgctgtctatggggtcgcacagagtcggacacaactgaagcgact 95647 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 50286 tggtaaagaatccacctgcaatgcaggagacctgggttcgatccctgggtcgggaagatc 50227 Query: 366 ccccggagaagg 377 || ||||||||| Sbjct: 50226 ccacggagaagg 50215 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 60824 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 60765 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 60764 gcctggtgggct 60753 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| || || |||||| ||| |||||||||| Sbjct: 79173 ggagaaggaaatggcaacccactccagtgttcttgactggagaatcccagggacagggga 79232 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 79233 gcctggtgggct 79244 Score = 63.9 bits (32), Expect = 9e-08 Identities = 77/92 (83%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 ||||| |||||| |||||||| ||||| ||||||||||| ||| | ||| || ||| | Sbjct: 78402 gggaaaatccccttgagaagggcatggcagcccactccagtgttcttacctggaaaatcc 78461 Query: 417 cacggacaggggagcctggcgggctacagtcc 448 || |||||| ||||||||| |||||||||||| Sbjct: 78462 catggacagaggagcctggtgggctacagtcc 78493 Score = 63.9 bits (32), Expect = 9e-08 Identities = 80/96 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||| |||||||||||||| || ||| ||| |||||| || |||||| ||||||||| Sbjct: 12396 tggtcaagaatctgcctgccgtgtgggagacctgggttcgatctctgggttgggaagatc 12455 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 || ||||||||||| ||| ||||||||||||||| Sbjct: 12456 ccgaggagaagggaacagcttcccactccagtattc 12491 Score = 61.9 bits (31), Expect = 3e-07 Identities = 73/87 (83%) Strand = Plus / Plus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| ||||||| ||| |||| |||||||||||| || |||||| ||||||||| || Sbjct: 21307 aatggcaacccacttcagaattcttgcctagagaatcgcatggacagaggagcctggtgg 21366 Query: 439 gctacagtccctagggttgaaaagagt 465 ||| |||||| | ||||| ||||||| Sbjct: 21367 gcttcagtccatgtggttgcaaagagt 21393 Score = 60.0 bits (30), Expect = 1e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||| ||| ||| || |||||||||||||| | ||||| || ||| ||| Sbjct: 90802 gaagatcccctggagtaggaaatagcaacccactccagtatccttgcctggaaaatccca 90743 Query: 419 cggacaggggagcctggc 436 |||||| |||||||||| Sbjct: 90742 tggacagaggagcctggc 90725 >gb|CM000202| Bos taurus chromosome 26-FRAG[31050000,31149999] Length = 100000 Score = 192 bits (97), Expect = 1e-46 Identities = 148/165 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||||||||||||| ||| ||| ||||||||||||||||| ||||||| Sbjct: 8414 atggtaaagagtctgcctgcaatgcaggagaccagggttcagtccctgggtcaggaagat 8355 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||||||||||||| |||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 8354 cccccggagaaggaaatggcaacccactccagtattcttgcctggagaattccatggaca 8295 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | |||||||||| ||||||||||| | |||||| ||||||||||| Sbjct: 8294 gaggagcctggcaggctacagtccatggggttgcaaagagttgga 8250 Score = 115 bits (58), Expect = 3e-23 Identities = 106/122 (86%) Strand = Plus / Plus Query: 314 aatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggag 373 ||||||||||||||| ||| ||| ||||| ||||||||| ||||||||||| |||| Sbjct: 80005 aatctgcctgcaatggaggagacctgggtttgatccctgggtcaggaagatcccctggag 80064 Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 |||||||||| |||| |||||||||||| ||||| |||||| ||| |||||||||||||| Sbjct: 80065 aagggaatgggtacctactccagtattcttgcctggagaattccatggacaggggagcct 80124 Query: 434 gg 435 || Sbjct: 80125 gg 80126 Score = 95.6 bits (48), Expect = 2e-17 Identities = 84/96 (87%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| |||| |||||| | ||||||| ||||||| | Sbjct: 79092 tggtaaagaatctgcctgcaatgcaggagaccctggttcaattcctgggttgggaagagc 79033 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| | ||||| ||| ||||||||| |||||||||| Sbjct: 79032 ccctgaagaagagaaaggctacccaatccagtattc 78997 Score = 95.6 bits (48), Expect = 2e-17 Identities = 123/144 (85%), Gaps = 3/144 (2%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| ||||| ||||| ||| || ||||||| |||||||||||| ||||| Sbjct: 72035 tggtaaagaatccacctgccaatgcaggagacatgggttcaatccctgggtggg-aagat 71977 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| || ||||||||||| ||||| |||||| ||| ||||| Sbjct: 71976 cccctggagaaggaaatggcaacttgctccagtattcttgcctggagaatcccatggaca 71917 Query: 425 ggggagcctggcgggctacagtcc 448 | |||| ||||||||||||||||| Sbjct: 71916 gaggag-ctggcgggctacagtcc 71894 Score = 85.7 bits (43), Expect = 2e-14 Identities = 67/75 (89%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||||||||||||| | |||||||||| |||||||| |||||| |||||||||||| | Sbjct: 50648 ggttcagtccctgggttgagaagatcccctggagaaggaaatggcaacccactccagtgt 50707 Query: 400 tcatgcctagagaat 414 || ||||| |||||| Sbjct: 50708 tcttgcctggagaat 50722 Score = 81.8 bits (41), Expect = 4e-13 Identities = 74/85 (87%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| ||||||| |||| |||||||||| ||||||||||| ||||| Sbjct: 78941 gggttcaatccctgggttgggaagagcccctagagaagggaaaggctacccacttcagta 78882 Query: 399 ttcatgcctagagaataccacggac 423 ||| |||| |||||| |||||||| Sbjct: 78881 ttctggcctggagaatcccacggac 78857 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 31753 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 31694 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 31693 gcctggtgggct 31682 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| | | ||| ||||| | |||||| ||||||||| Sbjct: 20487 tggtaaagaatccacctgcaatgcggaagacctgggtttgattcctgggctgggaagatc 20428 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||||||||||| ||||||||||||||||| Sbjct: 20427 ccctggagaagggaatggttacccactccagtattc 20392 Score = 75.8 bits (38), Expect = 2e-11 Identities = 96/114 (84%), Gaps = 1/114 (0%) Strand = Plus / Plus Query: 335 acccgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactcc 394 |||| |||||| ||||||||| ||||||||||| |||| ||| |||||| ||||||||| Sbjct: 9966 acccaggttcaatccctgggtcaggaagatcccctggaggaggaaatggccacccactcc 10025 Query: 395 agtattcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||||| ||||| | ||| ||| |||||| |||||| || ||||||||||| Sbjct: 10026 agtattcttgcct-ggcaattccatggacagaagagcctagcaggctacagtcc 10078 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| |||||||||||| ||| ||| ||||| Sbjct: 28281 ggagaaggaaatggcaacccactccagtgttcttgcctagagaatcccagggatggggga 28340 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 28341 gcctggtgggct 28352 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 57122 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 57063 Query: 430 gcctggcgggct 441 | |||| ||||| Sbjct: 57062 gtctggtgggct 57051 >gb|CM000202| Bos taurus chromosome 26-FRAG[30960000,31059999] Length = 100000 Score = 192 bits (97), Expect = 1e-46 Identities = 148/165 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||||||||||||| ||| ||| ||||||||||||||||| ||||||| Sbjct: 98414 atggtaaagagtctgcctgcaatgcaggagaccagggttcagtccctgggtcaggaagat 98355 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||||||||||||| |||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 98354 cccccggagaaggaaatggcaacccactccagtattcttgcctggagaattccatggaca 98295 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | |||||||||| ||||||||||| | |||||| ||||||||||| Sbjct: 98294 gaggagcctggcaggctacagtccatggggttgcaaagagttgga 98250 Score = 129 bits (65), Expect = 2e-27 Identities = 122/141 (86%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| || ||| |||||| ||||||||| ||||| |||| Sbjct: 21047 gtaaagaatctgcctgcaatgcatgagacctgggttcgatccctgggtcgggaaagtccc 21106 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| | |||||||||||||| ||||| ||||| ||| |||||| | Sbjct: 21107 ctggagaaggaaatggcaatccactccagtattcttgcctgaagaattccatggacagag 21166 Query: 428 gagcctggcgggctacagtcc 448 ||||||||||||||||||||| Sbjct: 21167 gagcctggcgggctacagtcc 21187 Score = 109 bits (55), Expect = 2e-21 Identities = 122/143 (85%), Gaps = 1/143 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaa-tgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 36324 tggtaaagaatctgcctgcaagtgcaggagacctgggttcgatccctgggttgggaagat 36383 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||| ||| |||||| ||| ||||| ||||| ||||| |||||| || ||| | Sbjct: 36384 cccctggaggaggaaatggcaacctgctccaatattcttgcctggagaatcgcatggata 36443 Query: 425 ggggagcctggcgggctacagtc 447 |||||||||||| |||||||||| Sbjct: 36444 ggggagcctggcaggctacagtc 36466 Score = 105 bits (53), Expect = 3e-20 Identities = 104/121 (85%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 |||||||| || | ||||||| ||||| ||| |||||||||||| ||||| |||||| || Sbjct: 66161 ggaagatctcctgaagaagggtatggcaacctactccagtattcttgcctggagaattcc 66102 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactg 477 | ||| || |||||||||||||||||||||| ||||||| ||||||| |||||||||| Sbjct: 66101 atggagagaggagcctggcgggctacagtccacagggttgtaaagagtcagatacaactg 66042 Query: 478 a 478 | Sbjct: 66041 a 66041 Score = 83.8 bits (42), Expect = 9e-14 Identities = 54/58 (93%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||||||| ||||||||||||||| |||||||||||||||| ||||| |||||| Sbjct: 69764 gggaagatcccctggagaagggaatggcaacccactccagtattcttgcctggagaat 69821 Score = 83.8 bits (42), Expect = 9e-14 Identities = 87/102 (85%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| || |||||||| ||| ||||||||||| |||||||||||||||| || | Sbjct: 4487 tccctgggtcagggagatcccctggaaaagggaatggcaacccactccagtattcttgtc 4428 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| || ||| ||| ||||| |||||||||||| Sbjct: 4427 tggagaatcccatgggcagaggaccctggtgggctacagtcc 4386 Score = 75.8 bits (38), Expect = 2e-11 Identities = 113/138 (81%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||| ||||||||||||||||||| ||| || | |||| ||||||||| ||| ||| Sbjct: 7305 atggtgaagaatctgcctgcaatgcgggagacacaggtttgatccctgggtcaggaggat 7246 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||| || || |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 7245 cccctggagaacaaaacagcaacccactccagtattcttgcctggagaattccatggaca 7186 Query: 425 ggggagcctggcgggcta 442 | ||||||||| ||||| Sbjct: 7185 gaagagcctggcaggcta 7168 Score = 73.8 bits (37), Expect = 9e-11 Identities = 131/161 (81%), Gaps = 1/161 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| ||||| ||||||||| ||| ||| Sbjct: 66416 tggtaaagaatcctcctgcaatgtgggagacctgggtttgatccctgggttggggagact 66475 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggaca 424 ||| ||||||||| |||||||| ||||||| ||||| ||||| | |||| ||| ||||| Sbjct: 66476 ccctggagaaggggatggctacgcactccattattcttgcctggggaatccccatggaca 66535 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||||||| ||||||| |||||| ||||| | ||||||| Sbjct: 66536 gaggagcctagcgggctgcagtccacagggtcgcaaagagt 66576 Score = 71.9 bits (36), Expect = 4e-10 Identities = 96/116 (82%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 338 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggcgga 397 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| || |||||| | ||||| || || |||||||||||| Sbjct: 398 gcctggtgggctgccgtctctggggttgcacagagtcagacacgactgaagcgact 453 Score = 69.9 bits (35), Expect = 1e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||| ||| |||||||||||| |||||||||| ||| | |||||||||||| Sbjct: 12582 ggttcaatccctaggtcgggaagatcccctagagaagggaacggcaatccactccagtat 12523 Query: 400 tcatgcctagagaat 414 || ||||| |||||| Sbjct: 12522 tcttgcctggagaat 12508 Score = 63.9 bits (32), Expect = 9e-08 Identities = 53/60 (88%) Strand = Plus / Minus Query: 388 ccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtc 447 |||||||||||||| ||||| |||||| ||| |||||| |||||||||| | |||||||| Sbjct: 13533 ccactccagtattcttgcctggagaatcccatggacagaggagcctggcagactacagtc 13474 Score = 60.0 bits (30), Expect = 1e-06 Identities = 111/138 (80%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 ||||||| |||||| || || ||| |||| ||||| ||||||||| ||||||||||| Sbjct: 80067 aaagaatttgcctgtaaggcaggagacccaggttcgatccctgggtcaggaagatcccct 80008 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||| | |||| | ||||||||||||| | ||||| || ||| | | |||||| || Sbjct: 80007 ggagaaagaaatgacaacccactccagtacacttgcctggaaaattctatggacagaaga 79948 Query: 430 gcctggcgggctacagtc 447 | ||||| |||||||||| Sbjct: 79947 ggctggcaggctacagtc 79930 >gb|CM000195| Bos taurus chromosome 19-FRAG[29160000,29259999] Length = 100000 Score = 190 bits (96), Expect = 6e-46 Identities = 144/160 (90%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| |||| |||||||||||||||| ||||||||| Sbjct: 34097 tggtaaagaatctgcctgcaatgcaggagacccaggttcagtccctgggttgggaagatc 34038 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||||||||||| ||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 34037 ccctggagaagggaatggctgcccactccagtattcttgcctggagaattccatggacag 33978 Query: 426 gggagcctggcgggctacagtccctagggttgaaaagagt 465 |||||||| |||||||||||| | |||||| ||||||| Sbjct: 33977 aggagcctgatgggctacagtccatggggttgcaaagagt 33938 Score = 137 bits (69), Expect = 7e-30 Identities = 138/161 (85%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 73456 atggtaaagaatctgcctgcaatgcaggagacctgggttcgatccctgggttgggaagat 73515 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||| ||||||| |||||||||||| |||| ||||| ||||| ||| || || Sbjct: 73516 cccctggagaaaggaatggatacccactccaggattcttgcctgaagaatcccatgggca 73575 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||||||| ||| ||||||| | |||| | ||||||| Sbjct: 73576 gaggagcctggcaggcaacagtccatggggtcgcaaagagt 73616 Score = 105 bits (53), Expect = 3e-20 Identities = 110/129 (85%) Strand = Plus / Plus Query: 320 cctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggga 379 |||||||||| ||| ||| | ||||| ||||||| | |||||||| || |||||||||| Sbjct: 34624 cctgcaatgcaggacacctgtgttcaatccctggctccggaagatctcctggagaaggga 34683 Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcggg 439 | ||| |||||||||||||||| ||||| |||||| || |||||| ||||||||| ||| Sbjct: 34684 acggcaacccactccagtattcttgcctggagaatttcatggacagaggagcctggtggg 34743 Query: 440 ctacagtcc 448 ||||||||| Sbjct: 34744 ctacagtcc 34752 Score = 103 bits (52), Expect = 1e-19 Identities = 85/96 (88%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| ||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 15476 tggtaaagaatctgcctgcagtgcaggagacctgggttcgatccctgggtttggaagatc 15417 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||||||||| || |||||||||||||||| Sbjct: 15416 ccctggagaagggaatagcaacccactccagtattc 15381 Score = 103 bits (52), Expect = 1e-19 Identities = 116/136 (85%), Gaps = 1/136 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| || | |||||||| ||||||||| ||||||| | Sbjct: 8324 ggtaaagaatctgcctgcaatgcaggggaaccgggttcgatccctgggtcaggaagattc 8383 Query: 367 ccc-ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||||||||||||||||| | |||||| ||||| |||||| ||| |||||| Sbjct: 8384 ccctggagaagggaatggctacccacactagtatttttgcctggagaattccaaggacag 8443 Query: 426 gggagcctggcgggct 441 |||||||| ||||| Sbjct: 8444 atgagcctggagggct 8459 Score = 97.6 bits (49), Expect = 6e-18 Identities = 100/117 (85%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||||||||||||||| ||| ||| |||||| ||||||||| |||||||||| Sbjct: 81960 ggtaaagaatctgcctgcaatgtgggagacctgggttcgatccctgggttgggaagatcc 81901 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 | ||||| ||||| ||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 81900 cttggagatgggaacagctacccactccagtattctggcctggagaattccatggac 81844 Score = 91.7 bits (46), Expect = 4e-16 Identities = 119/142 (83%), Gaps = 1/142 (0%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||| ||||||||| ||| ||| |||||| ||||||||| ||||||||||| Sbjct: 9512 gtaaagaatctgtctgcaatgcaggagacctaggttcaatccctgggttgggaagatccc 9453 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggacagg 426 | |||| || | |||| |||||||| ||||||| | ||| ||||| ||| |||||| Sbjct: 9452 ctggaggagagcctggcaacccactctagtattcttccctgaagaatccccaaggacaga 9393 Query: 427 ggagcctggcgggctacagtcc 448 ||||||||| |||||||||||| Sbjct: 9392 ggagcctggtgggctacagtcc 9371 Score = 89.7 bits (45), Expect = 2e-15 Identities = 99/117 (84%) Strand = Plus / Plus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| |||||||| |||||| | |||||||||||||| |||||||| ||| ||| || Sbjct: 94824 gatcccctggagaaggaaatggcaatccactccagtattcttgcctagaaaatcccatgg 94883 Query: 422 acaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||| |||||||| ||| || |||||| | || | ||||||||| ||| |||||||| Sbjct: 94884 acagaggagcctgccggactgcagtccatgggatggaaaagagtcggacacaactga 94940 Score = 81.8 bits (41), Expect = 4e-13 Identities = 68/77 (88%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||||||||| |||||||||||||||||||| ||| Sbjct: 40671 tccctgggttgggaagatcccctagagaagggaaaggctacccactccagtattctggcc 40612 Query: 407 tagagaataccacggac 423 | |||||| ||| |||| Sbjct: 40611 tggagaattccatggac 40595 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 ||||||||| |||||||| |||||| |||||||||||||||| ||||| | ||| | Sbjct: 1901 gaagatcccttggagaaggaaatggcaacccactccagtattcttgcctgggaaatcacg 1842 Query: 419 cggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaa 474 |||||| |||||||||||||||||||||| | |||| ||||||||||| |||| Sbjct: 1841 tggacagaggagcctggcgggctacagtccatggggtcacaaagagttggacacaa 1786 Score = 77.8 bits (39), Expect = 6e-12 Identities = 91/107 (85%), Gaps = 1/107 (0%) Strand = Plus / Plus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| ||||||||| || |||||||| |||||| |||||||||||||||| Sbjct: 48791 ttcaatccctgggtcgggaagatctcctggagaaggaaatggcaacccactccagtattc 48850 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||| | |||| || |||||| |||| |||| ||||| |||||| Sbjct: 48851 ttgcct-gggaatgacatggacagaggagactggtgggctgcagtcc 48896 Score = 77.8 bits (39), Expect = 6e-12 Identities = 84/99 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| || ||||||||| |||||||| |||||| |||||||||||||||| || Sbjct: 16706 tccctgggttggaaagatcccctggagaaggaaatggcaacccactccagtattcttgtt 16765 Query: 407 tagagaataccacggacaggggagcctggcgggctacag 445 | |||||| ||| || ||| | ||||||| ||||||||| Sbjct: 16766 tggagaattccatgggcagagaagcctggtgggctacag 16804 Score = 75.8 bits (38), Expect = 2e-11 Identities = 89/106 (83%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 |||||| ||||||||||||| | ||||| ||||| | ||| |||||||||| |||| Sbjct: 52547 taaagagtctgcctgcaatgtggaaaacctgggtttgatatctgagtggggaagaacccc 52606 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||| ||||| |||||||||||||||| ||||| |||||| Sbjct: 52607 tggagaagggcatggcaacccactccagtattcttgcctggagaat 52652 Score = 73.8 bits (37), Expect = 9e-11 Identities = 82/97 (84%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||| ||||| |||| |||| ||||| |||||||||||||||| |||| Sbjct: 32263 tccctgggtcaggaaggtcccctggaggagggcatggcaacccactccagtattcttgcc 32204 Query: 407 tagagaataccacggacaggggagcctggcgggctac 443 | |||||| ||| |||||| || |||| | ||||||| Sbjct: 32203 tggagaatcccatggacagaggggcctagtgggctac 32167 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||| |||||||||||||| ||| ||| |||| ||||| | |||||| ||||||||| Sbjct: 54576 tggtatagaatctgcctgcagtgcaggagaccccagttcaatttctgggttgggaagatc 54635 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | |||||||||| |||| ||||||||||||||| Sbjct: 54636 cgctggagaagggataggctgcccactccagtattc 54671 Score = 71.9 bits (36), Expect = 4e-10 Identities = 87/104 (83%) Strand = Plus / Minus Query: 311 aagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccg 370 |||||||||| |||||||| ||| ||| |||| |||||||| ||||||||| | | Sbjct: 41396 aagaatctgcatgcaatgcaggagaccgaggtttgatccctgggaccggaagatcctctg 41337 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaat 414 ||| |||||||||||| |||||||||||||| ||||| |||||| Sbjct: 41336 gagcagggaatggctatccactccagtattcttgcctggagaat 41293 Score = 69.9 bits (35), Expect = 1e-09 Identities = 90/107 (84%), Gaps = 1/107 (0%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| | || || ||| ||||||||| |||||||| | Sbjct: 65401 gtaaagaatctgcctgcaatgcaggaga-cctggctcaatccctgggtcaggaagatctc 65459 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat 414 | |||||||| ||||| | ||| |||||||||| ||||| |||||| Sbjct: 65460 ctggagaaggagatggcaatccattccagtattcttgcctggagaat 65506 Score = 69.9 bits (35), Expect = 1e-09 Identities = 87/103 (84%), Gaps = 1/103 (0%) Strand = Plus / Plus Query: 335 acccgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactcc 394 ||||||||||| ||||||||| | ||||||||| |||| || | ||||| |||||||| Sbjct: 95527 acccgggttcaatccctgggtcagaaagatcccctggaggagagcatggcaacccactct 95586 Query: 395 agtattcatgcctagagaa-taccacggacaggggagcctggc 436 ||||||| ||||| || || | ||| ||||||||||||||||| Sbjct: 95587 agtattcttgcctggaaaattcccatggacaggggagcctggc 95629 Score = 65.9 bits (33), Expect = 2e-08 Identities = 72/85 (84%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 ||||||||||||| |||||| |||||| |||||||||||||||| ||||| | ||| | Sbjct: 87232 gggaagatcccccaaagaaggaaatggcaacccactccagtattcttgcctgggaaatcc 87173 Query: 417 cacggacaggggagcctggcgggct 441 || ||| || ||||||||| ||||| Sbjct: 87172 catggagagaggagcctggtgggct 87148 Score = 65.9 bits (33), Expect = 2e-08 Identities = 83/97 (85%), Gaps = 2/97 (2%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacc-cgggttcagtccctgggtggggaagat 364 |||||||||||| |||||||||| ||| ||| |||||| | ||| ||||| |||||||| Sbjct: 15595 tggtaaagaatccccctgcaatgcaggagacctcgggttgattcc-tgggttgggaagat 15537 Query: 365 cccccggagaagggaatggctacccactccagtattc 401 | | |||||||||| |||||||||||||||||||| Sbjct: 15536 ctgctggagaagggataggctacccactccagtattc 15500 Score = 65.9 bits (33), Expect = 2e-08 Identities = 90/109 (82%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||| ||||| ||| ||| |||||| ||||||||| ||||| ||| Sbjct: 54695 tggtaaagaatcctcctgtaatgcaggagacctgggttcgatccctgggttgggaacatc 54754 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||| ||||||||||| |||| || || |||||||| |||| |||||| Sbjct: 54755 ccctggagaagggaaaggctgccgacctcagtattctggcctggagaat 54803 Score = 65.9 bits (33), Expect = 2e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 92960 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 92901 Query: 430 gcctg 434 ||||| Sbjct: 92900 gcctg 92896 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 88420 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 88479 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 88480 gcctggtgggct 88491 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||| || ||||||||||| ||| ||||| |||||| ||| |||||| ||| Sbjct: 76689 ggagaaggaaatcgcaccccactccagtgttcttgcctggagaatcccagggacagcgga 76630 Query: 430 gcctggcgggct 441 |||||||||||| Sbjct: 76629 gcctggcgggct 76618 Score = 58.0 bits (29), Expect = 5e-06 Identities = 71/85 (83%) Strand = Plus / Minus Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 |||| ||||||||| |||| | |||||||||||| || |||||||||||| ||| ||| Sbjct: 2280 tccctcggagaaggcaatgacaccccactccagtactcttgcctagagaatcccatggat 2221 Query: 424 aggggagcctggcgggctacagtcc 448 | ||||||||| ||||| |||||| Sbjct: 2220 ggaggagcctggtgggctgcagtcc 2196 >gb|CM000195| Bos taurus chromosome 19-FRAG[14130000,14229999] Length = 100000 Score = 190 bits (96), Expect = 6e-46 Identities = 169/192 (88%), Gaps = 1/192 (0%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| |||||||||| ||||||||| ||||||||||| Sbjct: 49585 gtaaagaatctgcctgcaatgcaggagacccgggttcgatccctgggttgggaagatccc 49526 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||||||||||| |||||||||||||||| ||||| |||||| ||| |||||| | Sbjct: 49525 ctggagaagggaatggcaacccactccagtattcttgcctggagaattccatggacagag 49466 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgactca 487 ||||||||| ||||||||||| | |||||| ||||||| || || ||| ||||||| | Sbjct: 49465 gagcctggcaggctacagtccatggggttgcaaagagtcagacacgtctg-agcgactaa 49407 Query: 488 cactttcacttt 499 |||||||||||| Sbjct: 49406 cactttcacttt 49395 Score = 139 bits (70), Expect = 2e-30 Identities = 106/118 (89%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||| ||||| ||||||| || ||| ||||||||||||||||||||| |||||||||| Sbjct: 79362 gtaaaaaatctacctgcaacgcaggagacccgggttcagtccctgggttaggaagatccc 79421 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 | |||||||||||||||||||||||||||||||| ||||| |||||| |||| ||||| Sbjct: 79422 ctggagaagggaatggctacccactccagtattcttgcctggagaattccacagacag 79479 Score = 129 bits (65), Expect = 2e-27 Identities = 116/133 (87%) Strand = Plus / Plus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 |||||||||||||| ||| ||| |||||| ||||||||| |||||||||||| |||||| Sbjct: 48922 tctgcctgcaatgcgggagacctgggttcgatccctgggtcgggaagatcccctggagaa 48981 Query: 376 gggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 || |||||| |||||||||||||||| ||||| |||||| || |||| | ||||||||| Sbjct: 48982 ggaaatggcaacccactccagtattcttgcctggagaatctcatggacggaggagcctgg 49041 Query: 436 cgggctacagtcc 448 |||||||||||| Sbjct: 49042 tgggctacagtcc 49054 Score = 127 bits (64), Expect = 7e-27 Identities = 112/128 (87%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| ||| || ||| ||||||||| |||||||| Sbjct: 35159 atggtaaagaatctgcctgcagtgcaggagacctggcttcgatccctgggttgggaagat 35218 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||| |||||||||||||||||||||||||| ||||| || ||| ||| ||||| Sbjct: 35219 cccctggagaggggaatggctacccactccagtattcttgcctggaaaatcccatggaca 35278 Query: 425 ggggagcc 432 | |||||| Sbjct: 35279 gaggagcc 35286 Score = 101 bits (51), Expect = 4e-19 Identities = 81/91 (89%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||||||||||||||||||||||| ||| ||||| |||| | || Sbjct: 25933 ggaagatcccctggagaagggaatggctacccactccagtgttcttgcctggagagtccc 25874 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | ||||| ||||||||| |||||||||||| Sbjct: 25873 agagacagaggagcctggagggctacagtcc 25843 Score = 99.6 bits (50), Expect = 2e-18 Identities = 83/94 (88%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||| |||||||||| ||| ||| ||||||| ||||||||| ||||| ||||| Sbjct: 78026 gtaaagaatccgcctgcaatgtgggagacctgggttcaatccctgggttgggaatatccc 77967 Query: 368 ccggagaagggaatggctacccactccagtattc 401 | ||||||||||| ||||||||||||| |||||| Sbjct: 77966 ctggagaagggaaaggctacccactcccgtattc 77933 Score = 99.6 bits (50), Expect = 2e-18 Identities = 89/102 (87%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| |||||||||||||||| || | Sbjct: 47267 tccctgggtcaggaagatcccctggagaaggcaatggcaacccactccagtattcttgtc 47326 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 |||||| ||| |||||| ||||||||| |||||||||||| Sbjct: 47327 gggagaatcccatggacagaggagcctggtgggctacagtcc 47368 Score = 97.6 bits (49), Expect = 6e-18 Identities = 88/101 (87%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| ||| |||| ||||| |||||||||||||||| |||| Sbjct: 60600 tccctgggttgggaagatcccctggaaaaggaaatggtaacccactccagtattcttgcc 60541 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtc 447 | |||||| ||| |||||| |||||||| ||||||||||| Sbjct: 60540 tggagaattccatggacagaagagcctggggggctacagtc 60500 Score = 91.7 bits (46), Expect = 4e-16 Identities = 94/110 (85%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||||||||||||| |||||||| ||| |||| ||| |||||| ||||||||||| | Sbjct: 11235 gggttcagtccctgggttgggaagatgccctggaggaggaaatggcaacccactccagca 11176 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| ||||| || ||| ||| ||||| ||||||||| ||||||||||| Sbjct: 11175 ttcttgcctggaaaattccatagacagaggagcctggttggctacagtcc 11126 Score = 89.7 bits (45), Expect = 2e-15 Identities = 78/89 (87%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| | ||| ||||||||||||||| |||| Sbjct: 17811 tccctgggtcgggaagatcccctggaggagggcacggcagcccactccagtattcttgcc 17752 Query: 407 tagagaataccacggacaggggagcctgg 435 | |||||| ||| |||||||||||||||| Sbjct: 17751 tggagaatcccatggacaggggagcctgg 17723 Score = 89.7 bits (45), Expect = 2e-15 Identities = 96/113 (84%) Strand = Plus / Minus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| ||||||||| || ||||||||| |||||||| |||||| | |||||||| | || Sbjct: 85666 gttcaatccctgggttggaaagatcccctggagaaggaaatggcaatccactccactgtt 85607 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtccctagg 453 | ||||| |||||| ||| ||||| ||||||||| |||||||||||| |||| Sbjct: 85606 cttgcctggagaatcccatagacagaggagcctggtgggctacagtccatagg 85554 Score = 87.7 bits (44), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||| ||| |||||| |||||||||||||||| ||||| |||||| ||| Sbjct: 4943 gaagatcccctggaggaggaaatggcaacccactccagtattcttgcctggagaatccca 4884 Query: 419 cggacaggggagcctggcgg 438 |||||| |||||||||||| Sbjct: 4883 tggacagaggagcctggcgg 4864 Score = 87.7 bits (44), Expect = 6e-15 Identities = 86/100 (86%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||| || |||||| | ||||||||||||||||||||||| ||||| Sbjct: 29002 cctgggttgggaagatctcctggagaatgaaatggctacccactccagtattcttgcctg 29061 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 || ||| ||| |||||| ||||||| | ||||||||||| Sbjct: 29062 gaaaatcccatggacagaggagcctcgtaggctacagtcc 29101 Score = 81.8 bits (41), Expect = 4e-13 Identities = 77/89 (86%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||| | |||||||| |||||| ||||||||||| |||| ||||| |||||| | Sbjct: 23904 gggaagatcctctggagaaggaaatggcaacccactccagcattcttgcctggagaatcc 23845 Query: 417 cacggacaggggagcctggcgggctacag 445 | |||||| ||||||||| ||||||||| Sbjct: 23844 cgtggacagaggagcctggtgggctacag 23816 Score = 81.8 bits (41), Expect = 4e-13 Identities = 107/129 (82%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| |||||| || |||||||||| ||||||| ||||| ||||||||||||| Sbjct: 71732 gggttcaatccctgagtcaggaagatccctaggagaagaaaatggtaacccactccagta 71791 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 ||| ||||| |||||| ||| | |||| ||||||||| | |||||||| | | |||||| Sbjct: 71792 ttcttgcctggagaatcccatgaacagaggagcctggagagctacagttcatggggttgc 71851 Query: 459 aaagagttg 467 ||||||||| Sbjct: 71852 aaagagttg 71860 Score = 75.8 bits (38), Expect = 2e-11 Identities = 86/102 (84%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | |||||||||||| |||| ||| || ||| |||| ||||||||||| |||| Sbjct: 82546 tccctggattgggaagatcccctggaggaggaaagggcaaccccctccagtattcttgcc 82487 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||||| |||||||| |||||| ||||| Sbjct: 82486 tggagaattccatggacagaagagcctggtgggctatagtcc 82445 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||| ||||||| ||| || || ||| | ||||||| ||||||| Sbjct: 56387 atggtaaagaatctgccagcaatgcaggagactgggattccattcctgggtcaggaagat 56446 Query: 365 cccccggagaagggaatggctacccactccagtatt 400 |||| |||| |||||||| | ||||||||||||||| Sbjct: 56447 cccctggaggagggaatgacaacccactccagtatt 56482 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 20487 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 20428 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 20427 gcctggtgggct 20416 Score = 61.9 bits (31), Expect = 3e-07 Identities = 58/67 (86%) Strand = Plus / Plus Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 ||||||||||| | |||||| ||||||| |||||||||||| || |||||| ||||||| Sbjct: 46101 aagggaatggcaatccactctagtattcttgcctagagaatcccgtggacagaggagcct 46160 Query: 434 ggcgggc 440 || |||| Sbjct: 46161 ggagggc 46167 Score = 58.0 bits (29), Expect = 5e-06 Identities = 74/89 (83%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||| ||||||| ||| || |||||| ||||||| |||||||| Sbjct: 69880 tggtaaagaatctgcccgcaatgcaggagacttgggttcgatccctggtctgggaagatt 69821 Query: 366 ccccggagaagggaatggctacccactcc 394 ||| |||||| | |||||| ||||||||| Sbjct: 69820 ccctggagaaagaaatggcaacccactcc 69792 >gb|CM000187| Bos taurus chromosome 11-FRAG[46350000,46449999] Length = 100000 Score = 190 bits (96), Expect = 6e-46 Identities = 144/160 (90%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||| || |||||||||||||||||| |||||||||| Sbjct: 44342 ggtaaagaatctgcctgcaatgcaggagactcgggttcagtccctgggttgggaagatcc 44283 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||||||||||||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 44282 cctggagaagggaatggcaacccactccagtattcttgcctggagaattccatggacaga 44223 Query: 427 ggagcctggcgggctacagtccctagggttgaaaagagtt 466 ||| ||||| |||||||||||| | || |||||||||||| Sbjct: 44222 ggaacctggtgggctacagtccatgggattgaaaagagtt 44183 Score = 111 bits (56), Expect = 4e-22 Identities = 124/144 (86%), Gaps = 2/144 (1%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| ||||| ||| ||| |||||| ||||||| | |||||||| Sbjct: 26691 tggtaaagaatctgcctgccaatgcaggagacctgggttcgatccctgg-tcgggaagat 26633 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| ||||||||||| ||| ||||| |||||| ||| ||||| Sbjct: 26632 cccctggagaagggaatggcagcccactccagtgttcttgcctggagaatcccatggaca 26573 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||||| ||| ||||||| Sbjct: 26572 gaggagcctggtgggtcacagtcc 26549 Score = 111 bits (56), Expect = 4e-22 Identities = 104/120 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| |||| ||||||||||| |||| Sbjct: 14903 tccctgggtcgggaagatcccctggaggagggcatggcaacccgctccagtattcttgcc 14962 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| ||||| ||||||||| |||||||||||| | |||||| |||||||| Sbjct: 14963 tggagaatcccatggacacaggagcctggtgggctacagtccatggggttgcaaagagtt 15022 Score = 109 bits (55), Expect = 2e-21 Identities = 76/83 (91%) Strand = Plus / Minus Query: 319 gcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggg 378 ||||||||||| ||| ||||||||||| ||||||||| ||||||||||| ||||||||| Sbjct: 96822 gcctgcaatgcaggagacccgggttcaatccctgggtcaggaagatcccctggagaaggg 96763 Query: 379 aatggctacccactccagtattc 401 |||||| |||||||||||||||| Sbjct: 96762 aatggcaacccactccagtattc 96740 Score = 97.6 bits (49), Expect = 6e-18 Identities = 134/161 (83%), Gaps = 1/161 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||||||| ||||| ||| ||| ||||||| || ||||||||||||||| Sbjct: 81047 tggtaaagaagctgcctgccaatgcaggagacctgggttcaatctctgggtggggaagat 80988 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||||||| |||||| ||||| ||||| |||| ||||| | ||| ||| ||||| Sbjct: 80987 cccttggagaaggaaatggcgacccaatccaggattcttgcctgggaaatcccatggaca 80928 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||| ||||| |||||| ||||| | | |||| ||||||| Sbjct: 80927 gaggaacctggtgggctatagtccatggagttgcaaagagt 80887 Score = 97.6 bits (49), Expect = 6e-18 Identities = 79/89 (88%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||| |||||| |||||||||||| ||| ||||| |||||| || Sbjct: 58621 ggaagatcccctggagaaggaaatggcaacccactccagtgttcttgcctggagaatccc 58680 Query: 418 acggacaggggagcctggcgggctacagt 446 | |||||| ||||||||| |||||||||| Sbjct: 58681 atggacagaggagcctggtgggctacagt 58709 Score = 93.7 bits (47), Expect = 1e-16 Identities = 160/195 (82%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||| |||||| |||| ||||| | ||| || | ||||| ||||||||| ||||||| Sbjct: 35750 atggttaagaatttgccagcaattcaggagactcaggttcgatccctgggtcaggaagat 35691 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||| | ||||||||||||||||||||||| | | | || ||| || ||||| Sbjct: 35690 cccctggagaaagaaatggctacccactccagtattc-ttcttggaaaatttcatggaca 35632 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | ||||||||| |||||||||||| | |||||| ||||||| |||| |||| || ||| Sbjct: 35631 gaggagcctggtgggctacagtccatggggttgcaaagagtcagatatgactg-agtgac 35573 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 35572 taacactttcacttt 35558 Score = 93.7 bits (47), Expect = 1e-16 Identities = 110/131 (83%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||| |||| ||| |||||| ||| |||| |||||| ||||||||| |||||||| Sbjct: 7311 tggtaaacaatcctcctccaatgcaggagacccaggttcaatccctgggtctggaagatc 7252 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||||||| || | ||| |||||||| |||||| ||||| ||| |||||| Sbjct: 7251 ccctggagaagggaatagcaaaccatcgcagtattcttgcctaaagaattccatggacag 7192 Query: 426 gggagcctggc 436 ||||||||||| Sbjct: 7191 gggagcctggc 7181 Score = 89.7 bits (45), Expect = 2e-15 Identities = 81/93 (87%) Strand = Plus / Plus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 |||||||||||||||| ||||| | ||| ||| |||||| ||||||||| ||||||||| Sbjct: 77469 acccactccagtattcttgcctgggaaatcccatggacagaggagcctggtgggctacag 77528 Query: 446 tccctagggttgaaaagagttggatacaactga 478 ||| | |||||| ||||||||||| |||||||| Sbjct: 77529 tccatggggttgcaaagagttggacacaactga 77561 Score = 85.7 bits (43), Expect = 2e-14 Identities = 83/95 (87%), Gaps = 1/95 (1%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctg-caatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||| |||||| ||| ||| |||||| |||| |||| ||||||| Sbjct: 2088 tggtaaagaatctgcctgtcaatgcaggagacctgggttcgatccccgggtcaggaagat 2147 Query: 365 cccccggagaagggaatggctacccactccagtat 399 |||| |||||||| |||||| |||||||||||||| Sbjct: 2148 cccctggagaaggaaatggcaacccactccagtat 2182 Score = 83.8 bits (42), Expect = 9e-14 Identities = 78/90 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | |||||||||||| |||| |||| || || || ||||||||||||| |||| Sbjct: 29759 tccctggattgggaagatcccctggaggagggcatagcaactcactccagtattcttgcc 29818 Query: 407 tagagaataccacggacaggggagcctggc 436 | |||||| |||||||||| |||||||||| Sbjct: 29819 tggagaatcccacggacagaggagcctggc 29848 Score = 81.8 bits (41), Expect = 4e-13 Identities = 77/89 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||| ||| |||||||| |||||| | ||||||||||| || |||| Sbjct: 70911 tccctgggtcgggaagattccctggagaaggaaatggcaatccactccagtactcttgcc 70852 Query: 407 tagagaataccacggacaggggagcctgg 435 |||| ||| ||| |||||| ||||||||| Sbjct: 70851 tagaaaatcccatggacagaggagcctgg 70823 Score = 79.8 bits (40), Expect = 1e-12 Identities = 118/144 (81%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||| | || ||| ||||| ||||||||| |||| || Sbjct: 89457 atggtaaagaatctgcctgcaatacaggggacctgggtttgatccctgggtcaggaatat 89398 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||| ||| |||||||||||| ||||| || ||| ||| || || Sbjct: 89397 cccctggagaagggaatggtaacctactccagtattcttgcctggaaaatcccatgggca 89338 Query: 425 ggggagcctggcgggctacagtcc 448 | ||| |||| ||| |||||||| Sbjct: 89337 gaggaccctgatggggtacagtcc 89314 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 41714 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 41773 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 41774 gcctggtgggct 41785 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 83587 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacagagga 83646 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 83647 gcctggtgggct 83658 Score = 75.8 bits (38), Expect = 2e-11 Identities = 65/74 (87%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||| ||||| |||| ||| |||||| ||||||||||||| Sbjct: 94492 gggttcaatccctgggttgggaagttcccctggaggaggaaatggcaacccactccagta 94551 Query: 399 ttcatgcctagaga 412 ||| ||||| |||| Sbjct: 94552 ttcctgcctggaga 94565 Score = 75.8 bits (38), Expect = 2e-11 Identities = 98/118 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| ||| || || || |||||| ||||||||| Sbjct: 35935 tggtaaagaatccacctgcaatgcgggagacctggctttgatctctgggttgggaagatc 35994 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| | ||||||||||||||||| |||| |||||| ||| |||| Sbjct: 35995 ccctggagaagggaaagattacccactccagtattctggcctggagaattccatggac 36052 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| |||||| Sbjct: 72071 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatagggga 72130 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 72131 gcctggtgggct 72142 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||| ||||||||||| ||||| |||||| ||| |||| ||||| Sbjct: 31038 ggagaaggcaatggcaaccccctccagtattcttgcctggagaatcccagggacggggga 30979 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 30978 gcctggtgggct 30967 Score = 71.9 bits (36), Expect = 4e-10 Identities = 108/132 (81%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||| ||||| |||| | || ||||| |||||||||||||||| | || Sbjct: 18774 tccctgggttgggaaagtcccctggaggaaggcatggcaacccactccagtattctttcc 18715 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| | | |||||| ||||||| | |||||||||||| | |||| |||||| | Sbjct: 18714 tggagaattcaatggacagaggagccttgtgggctacagtccatggggtcacaaagagct 18655 Query: 467 ggatacaactga 478 ||| |||||||| Sbjct: 18654 ggacacaactga 18643 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| |||||| Sbjct: 71788 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatagggga 71847 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 71848 gcctggtgggct 71859 Score = 71.9 bits (36), Expect = 4e-10 Identities = 78/92 (84%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||||| |||| ||| ||| || | |||||||||||||| ||||| |||||| | Sbjct: 33286 gggaagatcccctggagtaggaaatagcaaaccactccagtattcttgcctggagaatcc 33345 Query: 417 cacggacaggggagcctggcgggctacagtcc 448 || |||||| ||||||||| | ||||||||| Sbjct: 33346 catggacagaggagcctggaagactacagtcc 33377 Score = 69.9 bits (35), Expect = 1e-09 Identities = 92/111 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||| ||| |||||||| |||||| |||| ||||||||||| |||| Sbjct: 56660 tccctgggttgggaagatgccctggagaaggaaatggcaaccctctccagtattcttgcc 56601 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 | | ||| ||| |||||| |||||| |||||||||||| | |||||| Sbjct: 56600 tgggaaatcccatggacagacaggcctggtgggctacagtccatggggttg 56550 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| |||||||||||| ||| |||| Sbjct: 16099 tccctgggtcaggaagatcccctggagaaggaaatggcaacccactccagtgttcttgcc 16040 Query: 407 tagaga 412 | |||| Sbjct: 16039 tggaga 16034 Score = 63.9 bits (32), Expect = 9e-08 Identities = 89/108 (82%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| | | |||||| |||||||||||||||| || || | ||| || Sbjct: 92103 ggaagatcccctggaggacgaaatggcaacccactccagtattcttgactgggaaatccc 92162 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| ||| |||||||||||| ||||| | || ||| ||||||| Sbjct: 92163 atggacagaggaacctggcgggctatagtccatgggattgcaaagagt 92210 Score = 61.9 bits (31), Expect = 3e-07 Identities = 49/55 (89%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||| ||| |||||||||||| |||| ||| |||||| |||||||||||||||| Sbjct: 68206 tccctaggttgggaagatcccctggaggaggaaatggcaacccactccagtattc 68260 Score = 60.0 bits (30), Expect = 1e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||| | |||||||||| |||||||||||| ||| |||| ||| Sbjct: 8064 ggagaaggaaatggcaacctaatccagtattcttgcctagagaatcccatggaccaagga 8123 Query: 430 gcctggcgggctacagtccctagggt 455 ||||||| || | |||||| |||||| Sbjct: 8124 gcctggcagggtgcagtccatagggt 8149 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||| |||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 2751 ggagaaggaaatggcaacccattccagtgttcttgcctggagaatcccagggacggggga 2810 Query: 430 gcctgg 435 |||||| Sbjct: 2811 gcctgg 2816 Score = 60.0 bits (30), Expect = 1e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccct 351 |||||||||||||||||||||||| ||| |||| |||||| ||||| Sbjct: 17494 tggtaaagaatctgcctgcaatgcaggagacccaggttcaatccct 17539 Score = 58.0 bits (29), Expect = 5e-06 Identities = 80/97 (82%) Strand = Plus / Plus Query: 389 cactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||||||||||| ||| |||||| |||||||||| || |||||| |||||||||||| Sbjct: 79308 cactccagtattctcacctggagaatcccacggacagaggggcctggagggctacagtcc 79367 Query: 449 ctagggttgaaaagagttggatacaactgaagcgact 485 | |||| | ||||| ||| |||||||||| |||| Sbjct: 79368 atggggtcacacagagtcggacacaactgaagtgact 79404 Score = 58.0 bits (29), Expect = 5e-06 Identities = 80/97 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||| ||| ||| | || ||||||||||||| |||| Sbjct: 34795 tccctgggttaggaagatcccctggaggaggaaatatcaacacactccagtattcttgcc 34736 Query: 407 tagagaataccacggacaggggagcctggcgggctac 443 | |||||| ||| |||||| ||| |||| ||||||| Sbjct: 34735 tggagaatcccatggacagaggaagctggtgggctac 34699 >gb|CM000177| Bos taurus chromosome 1-FRAG[135810000,135909999] Length = 100000 Score = 188 bits (95), Expect = 2e-45 Identities = 171/195 (87%), Gaps = 1/195 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||||| ||| |||||| || |||||||| Sbjct: 26115 atggtaaagaatctgcctgcaatgcaggacacccggtttccatccctgagtcgggaagat 26056 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || ||||||||||||||||||||||| |||||||| ||||| |||||||||| | ||| Sbjct: 26055 ctcctggagaagggaatggctacccacttcagtattcttgcctggagaataccatgaaca 25996 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | ||||||||||||||| ||| || | |||||| ||||||||||||||||||| || ||| Sbjct: 25995 gaggagcctggcgggcttcagcccatggggttgcaaagagttggatacaactg-agtgac 25937 Query: 485 tcacactttcacttt 499 | |||||||| |||| Sbjct: 25936 tgacactttcgcttt 25922 Score = 115 bits (58), Expect = 3e-23 Identities = 85/94 (90%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 37169 tggtaaagaatccgcctgcaatgtgggagacctgggttcaatccctgggttgggaagatc 37110 Query: 366 ccccggagaagggaatggctacccactccagtat 399 ||| ||||||||||| |||||||||||||||||| Sbjct: 37109 ccctggagaagggaaaggctacccactccagtat 37076 Score = 111 bits (56), Expect = 4e-22 Identities = 122/144 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| |||||||||| ||| ||| ||||||||||| ||||| || |||||||| Sbjct: 87539 atggtaaagtgtctgcctgcagtgcgggagacccgggttcaatccctcagttgggaagat 87598 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| ||||||||||||| || ||||| || ||| ||| |||| Sbjct: 87599 cccctggagaaggaaatggcaacccactccagtactcttgcctggaaaattccatggact 87658 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||||| ||||||||||| Sbjct: 87659 gaggagcctggtaggctacagtcc 87682 Score = 85.7 bits (43), Expect = 2e-14 Identities = 133/163 (81%) Strand = Plus / Minus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 ||||||||||||| ||| |||| |||| ||||||||| |||||||||||| |||||| Sbjct: 99649 tctgcctgcaatgtgggagaccccggtttgatccctgggtcgggaagatcccctggagaa 99590 Query: 376 gggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 | |||||| ||||||||||||||| ||||| |||||| ||| ||| ||||||||| Sbjct: 99589 gaaaatggcagcccactccagtattcttgcctggagaatcccatggaggaaggagcctgg 99530 Query: 436 cgggctacagtccctagggttgaaaagagttggatacaactga 478 ||||| |||||| |||||| ||||||| ||| || ||||| Sbjct: 99529 tgggctgcagtccacggggttgcaaagagtcggacacgactga 99487 Score = 85.7 bits (43), Expect = 2e-14 Identities = 82/95 (86%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||| ||||||||||| | ||| ||| ||||||| |||||| || |||||||||| Sbjct: 26288 ggtaaagagtctgcctgcaacacaggagacctgggttcaatccctgagtcgggaagatcc 26347 Query: 367 cccggagaagggaatggctacccactccagtattc 401 || |||||||| |||||| |||||||| ||||||| Sbjct: 26348 cctggagaaggaaatggcaacccactcgagtattc 26382 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||| || Sbjct: 36016 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagcaga 35957 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 35956 gcctggtgggct 35945 >gb|CM000177| Bos taurus chromosome 1-FRAG[99720000,99819999] Length = 100000 Score = 188 bits (95), Expect = 2e-45 Identities = 131/143 (91%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||| ||||||||| ||| ||||||||||| ||||||||| ||||||||| Sbjct: 30612 tggtaaagaatctgtctgcaatgcaggagacccgggttcaatccctgggttgggaagatc 30671 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| ||||||||||||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 30672 ccctggagaagggaatggcaacccactccagtattcttgcctggagaatcccatggacag 30731 Query: 426 gggagcctggcgggctacagtcc 448 |||||||||||||||||||||| Sbjct: 30732 aggagcctggcgggctacagtcc 30754 Score = 121 bits (61), Expect = 4e-25 Identities = 121/141 (85%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||| |||||||||||||| ||| |||| ||||| ||||||||| |||||||||| Sbjct: 29973 gtaaagactctgcctgcaatgcaggagacccaggttccatccctgggtctggaagatccc 29914 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||||||||||| ||||| ||||||| || ||||| |||||| ||| |||||| | Sbjct: 29913 ctggagaagggaatggcaacccattccagtactcttgcctggagaatcccatggacagag 29854 Query: 428 gagcctggcgggctacagtcc 448 ||||||| | |||||||||| Sbjct: 29853 aagcctggtgagctacagtcc 29833 Score = 117 bits (59), Expect = 7e-24 Identities = 122/143 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| ||||||||| | |||| | ||||||||| Sbjct: 27183 tggtaaagaatctgcctgcaatgcaggagacccgggtttgattcctgcattgggaagatc 27242 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| | |||||| |||||| |||||||||||||||| |||||||||||| ||| ||| || Sbjct: 27243 ccctgcagaaggaaatggcaacccactccagtattcttgcctagagaatcccatggagag 27302 Query: 426 gggagcctggcgggctacagtcc 448 ||||||||| ||||| ||||| Sbjct: 27303 aggagcctggaaggctatagtcc 27325 Score = 109 bits (55), Expect = 2e-21 Identities = 109/127 (85%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||| || |||||||||||| |||| |||| ||||| ||||||||||||| Sbjct: 39590 gggttcaatccctaggatgggaagatcccctggaggagggcatggcaacccactccagta 39531 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 ||| ||||| |||||| ||| |||||| |||||||||| |||||| || | |||||||| Sbjct: 39530 ttcttgcctggagaattccatggacagaggagcctggcaggctactgtgcatagggttgc 39471 Query: 459 aaagagt 465 ||||||| Sbjct: 39470 aaagagt 39464 Score = 107 bits (54), Expect = 6e-21 Identities = 90/102 (88%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||| | |||| |||||||||| ||||||| |||||||| |||| Sbjct: 72025 tccctgggttgggaagatctgctggaggagggaatggcaacccactgcagtattcttgcc 71966 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 |||||||| ||| ||||| |||||||||||||||||||||| Sbjct: 71965 tagagaatcccatggacaaaggagcctggcgggctacagtcc 71924 Score = 101 bits (51), Expect = 4e-19 Identities = 93/107 (86%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||| ||||| |||| ||| || | |||||||||||| || |||||||||| Sbjct: 99138 gtaaagaatccacctgccatgcaggagacaagagttcagtccctgcatgaggaagatccc 99197 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat 414 | |||||||||||||||||||||||||||||||| ||||| |||||| Sbjct: 99198 ctggagaagggaatggctacccactccagtattcttgcctggagaat 99244 Score = 97.6 bits (49), Expect = 6e-18 Identities = 106/125 (84%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||||||| || || |||||||||||| ||||||||||||||| ||||||||||||| Sbjct: 94904 gggttcagtccttgtgttgggaagatcccctggagaagggaatggcaacccactccagta 94963 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 ||| ||||| || ||| | || ||| ||||||||| ||||| |||||| | |||| || Sbjct: 94964 ttcttgcctggataatcctgtgggcagaggagcctggtgggcttcagtccatggggtcga 95023 Query: 459 aaaga 463 ||||| Sbjct: 95024 aaaga 95028 Score = 97.6 bits (49), Expect = 6e-18 Identities = 133/161 (82%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| ||||| |||||| ||| |||| |||| | |||||||||||||||||| Sbjct: 11205 atggtaaagagtctgctcgcaatgagggagacccaggtttattccctgggtggggaagat 11264 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| | ||||||||||||| ||||| | ||| ||| ||| Sbjct: 11265 cccctggagaaggaaatggcaatacactccagtattcttgcctgggaaattccatggatg 11324 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||||||||| ||| |||||||| | |||||| ||||||| Sbjct: 11325 gaggagcctggagggatacagtccatggggttgcaaagagt 11365 Score = 93.7 bits (47), Expect = 1e-16 Identities = 80/91 (87%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| |||| ||||| |||||||||||||||| ||||| |||||| || Sbjct: 70331 ggaagatcccctggaggagggcatggcaacccactccagtattcttgcctggagaatccc 70390 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| | |||||||| ||||||||||| Sbjct: 70391 atggacagagcagcctggcaggctacagtcc 70421 Score = 93.7 bits (47), Expect = 1e-16 Identities = 126/151 (83%), Gaps = 1/151 (0%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||| | ||| || |||||||| ||||| |||||||| ||||| Sbjct: 35364 cctgggttgggaagatcctcgagaggtggaaatggctaaccacttcagtattcttgcctg 35423 Query: 409 gagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttgg 468 |||||| ||| |||||| ||||||| | |||| ||||||| |||| ||| ||||||||| Sbjct: 35424 gagaattccatggacagaggagcctcgtgggccacagtccataggcttgcaaagagttgt 35483 Query: 469 atacaactgaagcgactcacactttcacttt 499 ||| ||||| |||||| ||||||||||||| Sbjct: 35484 ataggactga-gcgactaacactttcacttt 35513 Score = 89.7 bits (45), Expect = 2e-15 Identities = 102/121 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||| |||||| ||||||||||||| || ||||| || ||| || Sbjct: 77287 ggaagatcccctggagaaggaaatggcaacccactccagtactcttgcctggaaaatccc 77228 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactg 477 | |||| | ||||||||| ||||||||||| | |||||| ||||||| ||| || |||| Sbjct: 77227 atggacggaggagcctggtaggctacagtccatggggttgcaaagagtcggacacgactg 77168 Query: 478 a 478 | Sbjct: 77167 a 77167 Score = 83.8 bits (42), Expect = 9e-14 Identities = 111/134 (82%) Strand = Plus / Minus Query: 315 atctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggaga 374 ||||| || |||||| ||| ||| ||||||| ||||||||| ||||||||||| ||||| Sbjct: 80639 atctgtctacaatgcgggagacctgggttcaatccctgggttgggaagatcccttggaga 80580 Query: 375 agggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctg 434 ||| |||||| | ||||||||||| | ||||| || ||| ||| |||||| |||||||| Sbjct: 80579 aggaaatggcaatccactccagtactattgcctggaaaatcccatggacagaggagcctg 80520 Query: 435 gcgggctacagtcc 448 | | ||||||||| Sbjct: 80519 gtagactacagtcc 80506 Score = 81.8 bits (41), Expect = 4e-13 Identities = 120/145 (82%), Gaps = 1/145 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaa-tgctggaaacccgggttcagtccctgggtggggaaga 363 |||||||||||||||||||| | ||| | | || | ||||| ||||| | | ||||||| Sbjct: 38088 atggtaaagaatctgcctgctagtgcagaagacacaggttcgatccctagattgggaaga 38147 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| |||||||| |||||| |||||||||||||||| ||| | | ||||||| |||| Sbjct: 38148 tcccctggagaaggaaatggcgacccactccagtattcttgcttgggaaataccatggac 38207 Query: 424 aggggagcctggcgggctacagtcc 448 || | ||||||| |||||| ||||| Sbjct: 38208 agagaagcctggtgggctaaagtcc 38232 Score = 81.8 bits (41), Expect = 4e-13 Identities = 65/73 (89%) Strand = Plus / Plus Query: 375 agggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctg 434 |||| ||||| |||||||||||||||| ||||| |||||| ||| |||||| |||||||| Sbjct: 40566 agggcatggcaacccactccagtattcttgcctggagaattccatggacagaggagcctg 40625 Query: 435 gcgggctacagtc 447 ||||| ||||||| Sbjct: 40626 gcgggttacagtc 40638 Score = 77.8 bits (39), Expect = 6e-12 Identities = 111/135 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| ||||||||||||| || |||| Sbjct: 19870 tccctgggtcaggaagatcccctggagaaggaaatggcaacccactccagtactcttgcc 19811 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 |||||| ||| ||||| |||||||||| ||| || |||| ||||| | |||||| Sbjct: 19810 cggagaatcccatggacaaaggagcctggcaggcgaccgtccacagggtcacacagagtt 19751 Query: 467 ggatacaactgaagc 481 ||| || |||||||| Sbjct: 19750 ggacacgactgaagc 19736 Score = 77.8 bits (39), Expect = 6e-12 Identities = 99/119 (83%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| ||||||| ||| |||||||| | |||| ||||||||||||| Sbjct: 84149 gggttcaatccctgggtcaggaagattccctggagaaggaactggcaacccactccagta 84090 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 ||| ||||| | ||| || |||||| | ||| |||||||||||||||| | |||||| Sbjct: 84089 ttcttgcctgggaaatcccttggacagagtagcttggcgggctacagtccatggggttg 84031 Score = 73.8 bits (37), Expect = 9e-11 Identities = 79/93 (84%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||| |||||||||| ||| ||| ||||| ||||||||| |||| |||| | Sbjct: 41306 taaagaatccgcctgcaatgtgggacacctgggtttgatccctgggttgggacaatcctc 41365 Query: 369 cggagaagggaatggctacccactccagtattc 401 ||||| |||||||||||||||||||||||||| Sbjct: 41366 tggagatgggaatggctacccactccagtattc 41398 Score = 73.8 bits (37), Expect = 9e-11 Identities = 70/81 (86%) Strand = Plus / Plus Query: 317 ctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaag 376 |||||||||||| |||| | | |||||| ||||||||| |||||||| ||| ||||||| Sbjct: 24844 ctgcctgcaatggtggagccacaggttcaatccctgggttgggaagattccctggagaag 24903 Query: 377 ggaatggctacccactccagt 397 | |||||| |||||||||||| Sbjct: 24904 gaaatggcaacccactccagt 24924 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 33271 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 33330 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 33331 gcctggtgggct 33342 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 82683 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 82742 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 82743 gcctggtgggct 82754 Score = 69.9 bits (35), Expect = 1e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||| |||| ||||||||| ||||||||||||| | |||||||||||||||| Sbjct: 28767 tccctggatgggaaagatcccctggagaagggaatgacaacccactccagtattc 28713 Score = 67.9 bits (34), Expect = 6e-09 Identities = 85/102 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| ||||||||||||||| |||| ||| |||||| ||||| || |||||| |||| Sbjct: 98034 tccctgtgtggggaagatcccctggagtaggaaatggcaacccagtctggtattcttgcc 98093 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| |||||| ||||||||| |||||| ||||| Sbjct: 98094 tgggaaattccatggacagaggagcctggtgggctatagtcc 98135 Score = 65.9 bits (33), Expect = 2e-08 Identities = 83/97 (85%), Gaps = 2/97 (2%) Strand = Plus / Plus Query: 347 tccctgggtggggaaga-tcccccggagaagggaatggctacccactccagtattcatgc 405 ||||||||| ||||||| | ||| |||| ||| |||||| ||| |||||||||||| ||| Sbjct: 32369 tccctgggttgggaagagttccctggaggaggaaatggcaacc-actccagtattcttgc 32427 Query: 406 ctagagaataccacggacaggggagcctggcgggcta 442 || ||| || ||| |||||| |||||||||||||||| Sbjct: 32428 ctggaggatcccatggacagaggagcctggcgggcta 32464 Score = 63.9 bits (32), Expect = 9e-08 Identities = 74/88 (84%) Strand = Plus / Minus Query: 378 gaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcg 437 ||||||| |||||||||||||||| ||||| ||||| ||| |||||| ||| | ||| | Sbjct: 42763 gaatggcaacccactccagtattcttgcctggagaactccatggacagaggaacttggtg 42704 Query: 438 ggctacagtccctagggttgaaaagagt 465 ||||| ||||| ||| |||| ||||||| Sbjct: 42703 ggctagagtccatagcgttgcaaagagt 42676 Score = 63.9 bits (32), Expect = 9e-08 Identities = 80/96 (83%) Strand = Plus / Plus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| |||||||| |||| ||||||| ||| || |||||||||||||||| || || | Sbjct: 78373 ctgggtcgggaagattccccagagaaggaaatagcaacccactccagtattcttgactgg 78432 Query: 410 agaataccacggacaggggagcctggcgggctacag 445 | ||| | | ||| || |||||||||| |||||||| Sbjct: 78433 aaaatgctagggagagtggagcctggcaggctacag 78468 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 27988 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 28047 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 28048 gcctggtgggct 28059 Score = 61.9 bits (31), Expect = 3e-07 Identities = 55/63 (87%) Strand = Plus / Plus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 |||||||||||||||| || || |||||| ||| |||||| ||||||||| |||||||| Sbjct: 64 acccactccagtattcttgactggagaatcccatggacagaggagcctggtaggctacag 123 Query: 446 tcc 448 ||| Sbjct: 124 tcc 126 Score = 61.9 bits (31), Expect = 3e-07 Identities = 64/75 (85%) Strand = Plus / Plus Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 |||| |||||| ||||||||||||||| ||||| |||||| ||| ||| | ||||||| Sbjct: 95926 aaggaaatggcaccccactccagtattcttgcctggagaatcccatggatggaggagcct 95985 Query: 434 ggcgggctacagtcc 448 || |||||||||||| Sbjct: 95986 ggtgggctacagtcc 96000 Score = 61.9 bits (31), Expect = 3e-07 Identities = 85/99 (85%), Gaps = 3/99 (3%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||| ||| ||||||| |||| |||||||| |||||| ||| |||||||||||| |||| Sbjct: 75619 tccctaggttgggaagaccccctggagaaggaaatggcaacc-actccagtattcttgcc 75677 Query: 407 t-agagaataccacggacaggggagcctggcgggctaca 444 | ||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 75678 tgaga-aatcccatggacagaggagcctggtgggctaca 75715 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| ||| ||||||||||||||||||||||| | ||||||||| ||| |||||| | | Sbjct: 55482 ggaggaggaaatggctacccactccagtattcttagctagagaattccatggacagagta 55541 Query: 430 gcctgg 435 |||||| Sbjct: 55542 gcctgg 55547 Score = 58.0 bits (29), Expect = 5e-06 Identities = 104/129 (80%) Strand = Plus / Plus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| |||||||||| | |||||||| |||||| ||||||||||| | ||||| | Sbjct: 25704 ctgggtcgggaagatccgctggagaaggaaatggcagtccactccagtactattgcctgg 25763 Query: 410 agaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | ||| ||| |||||| | ||||||| ||||||||||| | |||||| ||| ||| ||| Sbjct: 25764 aaaatcccatggacagagaagcctggtaggctacagtccatggggttgcaaaaagtcgga 25823 Query: 470 tacaactga 478 || ||||| Sbjct: 25824 cacgactga 25832 Score = 58.0 bits (29), Expect = 5e-06 Identities = 59/69 (85%) Strand = Plus / Plus Query: 373 gaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcc 432 ||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| |||||||| Sbjct: 29108 gaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatgggggagcc 29167 Query: 433 tggcgggct 441 ||| ||||| Sbjct: 29168 tggtgggct 29176 >gb|CM000194| Bos taurus chromosome 18-FRAG[27630000,27729999] Length = 100000 Score = 188 bits (95), Expect = 2e-45 Identities = 174/195 (89%), Gaps = 4/195 (2%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccggg-ttcagtccctgggtggggaagatcc 366 |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| Sbjct: 89087 gtaaagaatctgcctgcaatgcaggaaacccggggttcagtccctgggtggggaagatcc 89028 Query: 367 cccggagaagggaatggct-acccactccagtattcatgcct-agagaataccacggaca 424 || | ||| |||||||||| |||||||| ||||||| ||||| ||||||| ||| ||||| Sbjct: 89027 cctgcagatgggaatggctaacccactctagtattcttgcctaagagaatcccatggaca 88968 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | |||| ||||||||||||||||| | |||| | ||||||| ||| ||||||| |||||| Sbjct: 88967 gaggagtctggcgggctacagtccatggggtcgtaaagagtcggacacaactg-agcgac 88909 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 88908 taacactttcacttt 88894 Score = 119 bits (60), Expect = 2e-24 Identities = 111/128 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||| || ||| ||| ||| ||||||| |||||||||||| |||||| Sbjct: 429 tggtaaagaatctgcctacagtgcaggagacctgggttcaatccctgggtgggaaagatc 488 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| ||||||||||||| | |||||||||||||||| || || ||||| ||| |||||| Sbjct: 489 ccctggagaagggaatgccaacccactccagtattcttgtctgaagaattccagggacag 548 Query: 426 gggagcct 433 ||||||| Sbjct: 549 aggagcct 556 Score = 117 bits (59), Expect = 7e-24 Identities = 122/143 (85%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| || ||| ||| ||||| ||||||||| |||||||| Sbjct: 6476 tggtaaagaatctgcctgcagtgagggagacctgggtttgatccctgggtcaggaagatc 6417 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||| |||||| ||||||||||||| || |||||||| ||| ||| |||||| Sbjct: 6416 ccctggagaaggaaatggcaacccactccagtactcttgcctagaaaatcccatggacag 6357 Query: 426 gggagcctggcgggctacagtcc 448 ||||||||| ||||||||||| Sbjct: 6356 aggagcctggtaggctacagtcc 6334 Score = 111 bits (56), Expect = 4e-22 Identities = 147/176 (83%), Gaps = 1/176 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| || ||| ||||| ||||||||| |||||||| Sbjct: 69105 atggtaaagaatctgcctgcaatgcaagagacctgggtttgatccctgggtcgggaagat 69046 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||| ||||| | || ||||||||||| | ||||| |||||| ||| ||||| Sbjct: 69045 cccctggagaagagaatgtcaactcactccagtatccctgcctggagaatcccatggaca 68986 Query: 425 ggggagcctgg-cgggctacagtccctagggttgaaaagagttggatacaactgaa 479 | ||||||||| ||| |||| ||| | |||||| |||||| |||| || |||||| Sbjct: 68985 gaggagcctggtagggttacaatccatggggttgtaaagagctggacacgactgaa 68930 Score = 101 bits (51), Expect = 4e-19 Identities = 122/143 (85%), Gaps = 2/143 (1%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||| |||||| ||| ||| ||||||| ||||||||| ||||||||||| Sbjct: 7135 gtaaagaatctgcccgcaatgaaggagacctgggttcaatccctgggttgggaagatccc 7076 Query: 368 ccggagaagggaatggc-tacccactccagtattcatgcctagagaat-accacggacag 425 | |||| |||| ||||| |||||||||||||| | ||||| |||||| ||| |||||| Sbjct: 7075 ctggaggagggcatggcaaacccactccagtatccttgcctggagaatccccatggacag 7016 Query: 426 gggagcctggcgggctacagtcc 448 | |||||||| ||||||||||| Sbjct: 7015 agaagcctggcaggctacagtcc 6993 Score = 91.7 bits (46), Expect = 4e-16 Identities = 143/174 (82%), Gaps = 1/174 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||| |||||||||||||||||||| ||| || | |||||| ||||||||| ||||||| Sbjct: 11687 atgggaaagaatctgcctgcaatgcaggagacacaggttcaatccctgggtcaggaagat 11628 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || ||| ||| ||| || ||||| | ||||| |||| ||| |||||| ||| ||||| Sbjct: 11627 ctccttgagtaggaaatagcaacccatttcagtagtcatccctggagaattccatggaca 11568 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | |||||||||| ||| ||||||| ||||||| ||||||| ||| || ||||| Sbjct: 11567 gaggagcctggcaggc-acagtccacagggttgcaaagagtcggacacgactga 11515 Score = 87.7 bits (44), Expect = 6e-15 Identities = 108/128 (84%), Gaps = 1/128 (0%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatccccc-ggagaagggaatggctacccactccagt 397 ||||||| ||||||||| ||||||| |||| |||| |||| ||||| |||||||||||| Sbjct: 79159 gggttcaatccctgggtcaggaagatgcccctggaggagggcatggcaacccactccagt 79100 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 |||| ||||| |||||| ||| | |||| |||||||| |||||||||||| ||||| | Sbjct: 79099 attcttgcctggagaatcccatgaacagaggagcctgatgggctacagtccacagggtcg 79040 Query: 458 aaaagagt 465 ||||||| Sbjct: 79039 caaagagt 79032 Score = 87.7 bits (44), Expect = 6e-15 Identities = 65/72 (90%) Strand = Plus / Minus Query: 335 acccgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactcc 394 |||||| |||| | ||||||| |||||||||||| ||||||||||||||| ||||||||| Sbjct: 32827 acccggattcaattcctgggtcgggaagatcccctggagaagggaatggcaacccactcc 32768 Query: 395 agtattcatgcc 406 ||||||| |||| Sbjct: 32767 agtattcttgcc 32756 Score = 83.8 bits (42), Expect = 9e-14 Identities = 69/78 (88%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||| ||||| |||||||||||||||| ||||||||||||||| |||| Sbjct: 5532 tccctgggtcaggaagctcccctggagaagggaatggctgcccactccagtattcttgcc 5591 Query: 407 tagagaataccacggaca 424 | |||||| ||| ||||| Sbjct: 5592 tggagaatcccatggaca 5609 Score = 83.8 bits (42), Expect = 9e-14 Identities = 105/126 (83%) Strand = Plus / Plus Query: 360 aagatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccac 419 |||||| || |||| ||| |||||| |||||||||||||||| ||||| || ||| ||| Sbjct: 32141 aagatctccgggaggaggaaatggcaacccactccagtattcttgcctggaaaatcccat 32200 Query: 420 ggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaa 479 ||||| ||||||||||||||| |||||| |||||| ||||||| || ||| ||||| Sbjct: 32201 agacagaggagcctggcgggctgcagtccatagggtcataaagagtcagacacagctgaa 32260 Query: 480 gcgact 485 |||||| Sbjct: 32261 gcgact 32266 Score = 83.8 bits (42), Expect = 9e-14 Identities = 78/90 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||||| |||||||||||||||||||||| | ||| Sbjct: 7582 tccctgggtagggaagatcccctggagaacagaatggctacccactccagtatccttgca 7523 Query: 407 tagagaataccacggacaggggagcctggc 436 | |||||| || |||||| |||||||||| Sbjct: 7522 tggagaattccgtggacagaggagcctggc 7493 Score = 83.8 bits (42), Expect = 9e-14 Identities = 87/102 (85%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| |||||||||||| ||| |||| Sbjct: 33917 tccctgggtcaggaagatcccctggagaaggcaatggcaacccactccagtgttcttgcc 33858 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 || ||| ||| |||| | ||||||||| |||||||||||| Sbjct: 33857 gggaaaatcccatggaccgaggagcctggtgggctacagtcc 33816 Score = 81.8 bits (41), Expect = 4e-13 Identities = 92/109 (84%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||| |||||||||||| |||| ||| |||||| |||||||||||||| Sbjct: 93408 ggttcaatccctggtctgggaagatcccctggaggaggaaatggccacccactccagtat 93349 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 || ||||| || ||| ||| |||||| ||| ||||| ||||||||||| Sbjct: 93348 tcttgcctggaaaattccatggacagaggattctggcaggctacagtcc 93300 Score = 81.8 bits (41), Expect = 4e-13 Identities = 116/141 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||||||||||||| ||| ||| |||| | || |||||||||||||||| | || Sbjct: 69507 tccctgggtggggaagattccctggaagagggcagagcaacccactccagtattcttccc 69448 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| ||||||||| ||||||||||| || ||| || |||| Sbjct: 69447 tggagaatcccatggacagaggagcctggttggctacagtccataaggtcgacgagagcc 69388 Query: 467 ggatacaactgaagcgactca 487 ||| || |||||||||||||| Sbjct: 69387 ggacacgactgaagcgactca 69367 Score = 77.8 bits (39), Expect = 6e-12 Identities = 75/87 (86%) Strand = Plus / Plus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| | |||||||||||||| ||| |||| ||| ||| |||||||||||||||| || Sbjct: 65502 aatggcaaaccactccagtattcttgcttagaaaattccaaggacaggggagcctggggg 65561 Query: 439 gctacagtccctagggttgaaaagagt 465 |||||||||| | ||| || ||||||| Sbjct: 65562 gctacagtccgtgggggtgcaaagagt 65588 Score = 73.8 bits (37), Expect = 9e-11 Identities = 91/109 (83%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| |||| ||| | |||| ||||||| |||||| | ||||| Sbjct: 66109 cctgggttgggaagatcccctggaggaggaagtggcaacccacttcagtatgcttgcctg 66168 Query: 409 gagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 |||||| ||| |||||| |||||| | |||||||||||| | |||||| Sbjct: 66169 gagaatcccatggacagaggagcccagtgggctacagtccatggggttg 66217 Score = 73.8 bits (37), Expect = 9e-11 Identities = 76/89 (85%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||| |||||| ||||||||||||||| ||||| | ||| | Sbjct: 46417 ggaagatcccctggagaaggaaatggcaacccactccagtatttttgcctgggaaatctc 46358 Query: 418 acggacaggggagcctggcgggctacagt 446 | |||||| ||||||||||||||| |||| Sbjct: 46357 atggacagaggagcctggcgggctgcagt 46329 Score = 71.9 bits (36), Expect = 4e-10 Identities = 79/92 (85%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 |||||||| ||||| ||| |||| ||||| ||||||||| |||||||||||| ||| || Sbjct: 17135 tctgcctggaatgcgggagacccaggttcgatccctgggtcgggaagatcccctgga-aa 17193 Query: 376 gggaatggctacccactccagtattcatgcct 407 || |||||| ||||||||||||| || ||||| Sbjct: 17194 ggaaatggcaacccactccagtactcttgcct 17225 Score = 71.9 bits (36), Expect = 4e-10 Identities = 84/100 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || |||||||||| | |||| |||| ||||| |||||||||||||||| | || Sbjct: 78480 tccctgagttgggaagatccgctggaggagggcatggcaacccactccagtattcttacc 78539 Query: 407 tagagaataccacggacaggggagcctggcgggctacagt 446 | |||||| | | ||||| ||||||||| |||||||||| Sbjct: 78540 tggagaatcctatagacagaggagcctggtgggctacagt 78579 Score = 67.9 bits (34), Expect = 6e-09 Identities = 85/102 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||| ||| |||||||||||| |||| ||| ||||| |||||||| |||||| |||| Sbjct: 90957 tcccttggttgggaagatcccctggaggaggacatggcaacccactctggtattcttgcc 90898 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||| | |||||||||| ||||| ||||| Sbjct: 90897 tggagaatcccatggactgaggagcctggcaggctatagtcc 90856 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 52844 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 52903 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 52904 gcctggtgggct 52915 Score = 63.9 bits (32), Expect = 9e-08 Identities = 41/44 (93%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 7204 ggaagatcccctggagaagggataggctacccactccagtattc 7161 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| || | ||||| Sbjct: 86932 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggtcggggga 86873 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 86872 gcctggtgggct 86861 Score = 61.9 bits (31), Expect = 3e-07 Identities = 76/91 (83%) Strand = Plus / Plus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 ||||| |||||||||| ||||| | ||| ||||||| || ||||||||||||||||||| Sbjct: 91751 acccaatccagtattcttgcctgggaaattccacggatagaggagcctggcgggctacag 91810 Query: 446 tccctagggttgaaaagagttggatacaact 476 || | | |||| ||||||| ||||||||| Sbjct: 91811 tctgtggcgttgcaaagagtcagatacaact 91841 >gb|CM000188| Bos taurus chromosome 12-FRAG[12330000,12429999] Length = 100000 Score = 188 bits (95), Expect = 2e-45 Identities = 172/195 (88%), Gaps = 2/195 (1%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| |||| |||||| ||||||||| ||||||| Sbjct: 68581 atggtaaagaatctgcctgcagtgcaggagacccaggttcaatccctgggttgggaagaa 68640 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||| ||||||||||||||||||||||||||||| |||||| ||| ||||| Sbjct: 68641 cccctggagaaga-aatggctacccactccagtattcatgcctggagaatcccatggaca 68699 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | ||||||||| |||||||||||||| |||||| ||||||| ||| || |||| || ||| Sbjct: 68700 gaggagcctggtgggctacagtccctggggttgcaaagagtgggacacgactg-agtgac 68758 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 68759 taacactttcacttt 68773 Score = 137 bits (69), Expect = 7e-30 Identities = 147/173 (84%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| || ||||||| ||||||||| |||||||| || Sbjct: 54889 gtaaagaatctgcctgcaatgcaggagacacgggttcgatccctgggttgggaagatgcc 54830 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||| |||| ||||| | ||||||||| |||| ||||| |||||| ||| |||||| | Sbjct: 54829 ctggaggagggcatggcaatccactccagcattcttgcctggagaatcccatggacagag 54770 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaag 480 ||||||||| |||||||||| | | || | ||||||||||| |||||||||| Sbjct: 54769 gagcctggcacgctacagtccatggagtcgcaaagagttggacacaactgaag 54717 Score = 121 bits (61), Expect = 4e-25 Identities = 145/173 (83%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||| ||||||||||||||| ||| || ||||||| ||||||||| |||||||||| Sbjct: 5769 gtaaaaaatctgcctgcaatgtgggagacgtgggttcaatccctgggtcaggaagatccc 5710 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||||||||||||||||| || ||||||| ||||| ||||| ||| |||||| | Sbjct: 5709 ctggagaagggaatggctacccattcaagtattcttgcctggagaagtccatggacagag 5650 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaag 480 | |||| ||||||||||| | |||||| ||||||| ||| |||||||||| Sbjct: 5649 gcttctggaaggctacagtccatggggttgcaaagagtcggacacaactgaag 5597 Score = 119 bits (60), Expect = 2e-24 Identities = 108/124 (87%) Strand = Plus / Plus Query: 311 aagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccg 370 |||||||||||||||||| ||| ||| || ||| ||||||||| |||||||||||| | Sbjct: 61840 aagaatctgcctgcaatgtaggagacctggattcgatccctgggttgggaagatccccag 61899 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 |||||||||||||| ||||||||| |||||| ||||| |||||| ||| |||||| |||| Sbjct: 61900 gagaagggaatggcaacccactcctgtattcttgcctggagaattccatggacagaggag 61959 Query: 431 cctg 434 |||| Sbjct: 61960 cctg 61963 Score = 113 bits (57), Expect = 1e-22 Identities = 123/145 (84%) Strand = Plus / Plus Query: 304 aatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaaga 363 |||||||||||| | |||||||||| ||||| |||| || ||||||||| |||||| Sbjct: 76410 aatggtaaagaaaccacctgcaatgcaggaaatgtgggtacaatccctgggtcaggaaga 76469 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| |||||||||||| || | |||||||||||||| || ||||||||| ||| ||| Sbjct: 76470 tcccctggagaagggaatagcaatccactccagtattcttgtctagagaatcccatagac 76529 Query: 424 aggggagcctggcgggctacagtcc 448 || |||||||||||| ||||||||| Sbjct: 76530 agaggagcctggcggactacagtcc 76554 Score = 111 bits (56), Expect = 4e-22 Identities = 83/92 (90%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 ||||| |||||| ||||||||||||| | |||||||||||||||| |||||||||||| | Sbjct: 48304 gggaaaatcccctggagaagggaatgccaacccactccagtattcttgcctagagaattc 48245 Query: 417 cacggacaggggagcctggcgggctacagtcc 448 || |||||| |||||||||| ||||||||||| Sbjct: 48244 catggacagaggagcctggcaggctacagtcc 48213 Score = 97.6 bits (49), Expect = 6e-18 Identities = 103/121 (85%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| |||| ||| |||| ||||||||||||| || | |||| Sbjct: 287 atggtaaagaatctgcctgtgatgcaggagacccaggttcagtccctgagtcaagcagat 346 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| | | |||||||||||| ||||| |||||| ||| ||||| Sbjct: 347 cccctggagaagggaatggcaatctactccagtattcttgcctggagaattccatggaca 406 Query: 425 g 425 | Sbjct: 407 g 407 Score = 95.6 bits (48), Expect = 2e-17 Identities = 85/96 (88%), Gaps = 1/96 (1%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||| |||||||||||| ||| ||| |||||| |||||| || ||||||||| Sbjct: 3504 tggtaaagaat-tgcctgcaatgcaggagacctgggttcgatccctgagttgggaagatc 3446 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||||| ||||||||| |||||||||| Sbjct: 3445 ccctggagaagggaaaggctacccattccagtattc 3410 Score = 83.8 bits (42), Expect = 9e-14 Identities = 88/102 (86%), Gaps = 1/102 (0%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||| || |||||| |||||||||||| ||| |||| Sbjct: 41777 tccctgggtcgggaagatccct-ggaggagaaaatggcaacccactccagtgttcttgcc 41719 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||||| |||| ||||||||||||||||| Sbjct: 41718 tggagaatcccatggacagaggagtctggcgggctacagtcc 41677 Score = 79.8 bits (40), Expect = 1e-12 Identities = 100/120 (83%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||| |||||||||| |||| ||| ||| ||||| | ||||||| | |||| ||| Sbjct: 57512 tggtaaagcatctgcctgccatgcaggagacctgggtttaatccctggatcaggaatatc 57453 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| ||||||||||||| ||||||||||||| | ||||| |||||| |||||||||| Sbjct: 57452 ccctaaagaagggaatggcaacccactccagtaaccttgcctggagaatcccacggacag 57393 Score = 79.8 bits (40), Expect = 1e-12 Identities = 109/132 (82%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| | || |||| |||||||||| ||||||| Sbjct: 27826 atggtaaagaatctgcctgcagtgcgggagatccaggtttgatccctgggtgaggaagat 27767 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||||||||||||| | ||||||||| ||| || || | |||| ||| ||||| Sbjct: 27766 accctggagaagggaatggtaatccactccaggatttttgtctggggaattccatggaca 27707 Query: 425 ggggagcctggc 436 | |||||||||| Sbjct: 27706 gaggagcctggc 27695 Score = 77.8 bits (39), Expect = 6e-12 Identities = 78/91 (85%) Strand = Plus / Minus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 ||||||||||||||||||||||| |||||| | | | |||| ||||| ||| |||||| | Sbjct: 36741 aatggctacccactccagtattcttgcctaaaaattcccacagacagaggaacctggcag 36682 Query: 439 gctacagtccctagggttgaaaagagttgga 469 |||||||||| | || ||| ||||||||||| Sbjct: 36681 gctacagtccatgggattgcaaagagttgga 36651 Score = 77.8 bits (39), Expect = 6e-12 Identities = 84/99 (84%) Strand = Plus / Minus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| |||||||| ||| || |||| |||||| |||||||||||||||| | ||| | Sbjct: 70480 ctgggtagggaagattccctgggaaaggaaatggcaacccactccagtattcttacctgg 70421 Query: 410 agaataccacggacaggggagcctggcgggctacagtcc 448 |||| ||| |||||| |||||||||| ||||||||||| Sbjct: 70420 agaaccccatggacagaggagcctggcaggctacagtcc 70382 Score = 73.8 bits (37), Expect = 9e-11 Identities = 58/65 (89%) Strand = Plus / Plus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| |||||||||||| ||||||||| ||||| ||||||||||||||| ||||| | Sbjct: 40855 ctgggtcgggaagatcccctggagaagggtatggcagcccactccagtattcttgcctgg 40914 Query: 410 agaat 414 ||||| Sbjct: 40915 agaat 40919 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 84152 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 84093 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 84092 gcctggtgggct 84081 Score = 69.9 bits (35), Expect = 1e-09 Identities = 56/63 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| |||||||||||| ||| |||| | ||| Sbjct: 21945 ggagaaggcaatggcaacccactccagtattcttgcctagagaatcccagggacggagga 22004 Query: 430 gcc 432 ||| Sbjct: 22005 gcc 22007 Score = 69.9 bits (35), Expect = 1e-09 Identities = 87/103 (84%), Gaps = 1/103 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggc-tacccactccagtattcatgc 405 ||||||||| ||||||||||| | ||||||| |||| | ||||||||||||||| ||| Sbjct: 2945 tccctgggtcaggaagatcccctgaagaagggcatggtgtccccactccagtattcttgc 3004 Query: 406 ctagagaataccacggacaggggagcctggcgggctacagtcc 448 || |||||| ||| |||||| ||||||| | |||||| ||||| Sbjct: 3005 ctggagaatcccatggacagaggagcctcgtgggctatagtcc 3047 Score = 67.9 bits (34), Expect = 6e-09 Identities = 86/102 (84%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| |||||| || |||| |||| Sbjct: 59802 tccctgggttgggaagatcccctggaggagggcatggcaacccacccccatattgttgcc 59861 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||||| |||| |||| |||||||||||| Sbjct: 59862 tggagaatcccatggacagaggag-ctggtgggctacagtcc 59902 Score = 65.9 bits (33), Expect = 2e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| |||| |||||| ||| |||||||||||| ||| ||||| |||||| ||| || Sbjct: 96442 gatcccctggaggagggaacggcaacccactccagtcttcttgcctggagaatcccatgg 96383 Query: 422 acaggggagcctg 434 |||| |||||||| Sbjct: 96382 acagaggagcctg 96370 Score = 65.9 bits (33), Expect = 2e-08 Identities = 39/41 (95%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagta 398 ||||||||||| |||||||||| |||||||||||||||||| Sbjct: 82686 ggaagatcccctggagaagggagtggctacccactccagta 82726 Score = 63.9 bits (32), Expect = 9e-08 Identities = 84/100 (84%), Gaps = 1/100 (1%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| || | ||| |||||| |||||||| | |||| |||| Sbjct: 8657 tccctgggtcaggaagatcccctggggcaggaaatggcaacccactcg-gaattcttgcc 8715 Query: 407 tagagaataccacggacaggggagcctggcgggctacagt 446 | |||||| ||| |||||| |||||||| ||||||||||| Sbjct: 8716 tggagaatcccagggacagaggagcctgccgggctacagt 8755 Score = 63.9 bits (32), Expect = 9e-08 Identities = 65/76 (85%) Strand = Plus / Plus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||||| ||||||||| ||||| |||||| |||| |||| ||||| ||||||||||| Sbjct: 39147 cgggttcgatccctgggtcgggaaaatcccctggaggagggtatggcagcccactccagt 39206 Query: 398 attcatgcctagagaa 413 |||| ||||| ||||| Sbjct: 39207 attcttgcctggagaa 39222 Score = 63.9 bits (32), Expect = 9e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| || ||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 22080 ggagaaggaaatggcaacgcactccagtattcttgcctggagaatcccagggacagagga 22139 Query: 430 gcct 433 |||| Sbjct: 22140 gcct 22143 Score = 63.9 bits (32), Expect = 9e-08 Identities = 41/44 (93%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||||| |||||||| |||||| |||||||||||||||| Sbjct: 80273 ggaagatcccctggagaaggaaatggcaacccactccagtattc 80230 Score = 63.9 bits (32), Expect = 9e-08 Identities = 113/140 (80%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| |||||| |||| |||||||| |||||| || ||||| || || Sbjct: 31350 ggttcaatccctgggtcaggaagaccccctggagaaggaaatggcaactcactctagcat 31409 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 | ||||| | ||| ||| |||||| || || |||| ||||||||||| | |||| | | Sbjct: 31410 gcttgcctgggaaatcccatggacagaggggcgtggcaggctacagtccatggggtcgca 31469 Query: 460 aagagttggatacaactgaa 479 |||||||||| || |||||| Sbjct: 31470 aagagttggacacgactgaa 31489 Score = 58.0 bits (29), Expect = 5e-06 Identities = 53/61 (86%) Strand = Plus / Plus Query: 381 tggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgggc 440 |||| |||||||||||| ||| ||||| |||||| ||| |||| ||||||||||| |||| Sbjct: 19460 tggcaacccactccagtgttcttgcctggagaatcccagggacgggggagcctggtgggc 19519 Query: 441 t 441 | Sbjct: 19520 t 19520 Score = 58.0 bits (29), Expect = 5e-06 Identities = 59/69 (85%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||| || |||||||||||| |||||||| |||||| | |||||||| || Sbjct: 82099 gggttcaatcccttggctgggaagatcccctggagaaggaaatggcaatccactccaata 82158 Query: 399 ttcatgcct 407 ||| ||||| Sbjct: 82159 ttcttgcct 82167 >gi|112125186|gb|AAFC03053128.1| Bos taurus Ctg34.CH240-382O18, whole genome shotgun sequence, ChrUn.003.6762 Length = 8038 Score = 186 bits (94), Expect = 9e-45 Identities = 142/158 (89%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| ||| |||||||||||||| || ||||||||||| Sbjct: 3813 gtaaagaatctgcctgcaatgcaggagacctgggttcagtccctgagttgggaagatccc 3872 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| |||||||||||||||| ||||| |||||| |||||||||| | Sbjct: 3873 ctggagaaggaaatggcaacccactccagtattcttgcctggagaatcccacggacagag 3932 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagt 465 || |||||||||||||||||| | |||||| ||||||| Sbjct: 3933 gaacctggcgggctacagtccatggggttgcaaagagt 3970 Score = 85.7 bits (43), Expect = 2e-14 Identities = 118/143 (82%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||| |||||| ||| ||| ||||| | |||| || |||||||| Sbjct: 3588 tggtaaagaatctgcctacaatgcaggagacctgggtttgattcctgcgtcaggaagatc 3647 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 | | ||| |||| |||||| | |||||||||||||| ||||| ||||| ||| |||||| Sbjct: 3648 ctctggaaaaggaaatggcaaaccactccagtattcttgcctgaagaatcccatggacag 3707 Query: 426 gggagcctggcgggctacagtcc 448 |||||||||| |||| |||||| Sbjct: 3708 aggagcctggcaggctgcagtcc 3730 >gb|CM000185| Bos taurus chromosome 9-FRAG[23220000,23319999] Length = 100000 Score = 186 bits (94), Expect = 9e-45 Identities = 145/162 (89%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| |||||||||| | ||| |||| |||||| ||||||||| |||||||| Sbjct: 27293 atggtaaagaatatgcctgcaatacaggagacccaggttcaatccctgggtcgggaagat 27352 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| |||||||||||||||| ||||| |||||| ||||||||| Sbjct: 27353 cccctggagaagggaatggcaacccactccagtattcttgcctggagaattccacggaca 27412 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||||||||| ||||||||| |||||| | |||||||| Sbjct: 27413 gaggagcctggcggactacagtccatagggtagcaaagagtt 27454 Score = 135 bits (68), Expect = 3e-29 Identities = 113/128 (88%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||| |||||| ||||| ||| |||||||| Sbjct: 75655 atggtaaagaatctgcctgcaatgcaggagacccaggttcaatccctaggttgggaagat 75596 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||| ||||||| ||| |||||||||||| |||||||||||| ||| ||| | Sbjct: 75595 cccctggagaagagaatggcaacctactccagtattcttgcctagagaattccatggaaa 75536 Query: 425 ggggagcc 432 | |||||| Sbjct: 75535 gaggagcc 75528 Score = 121 bits (61), Expect = 4e-25 Identities = 115/133 (86%) Strand = Plus / Minus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 |||||||| ||||| ||| ||| |||||| |||||| || ||||||||||| |||||| Sbjct: 91777 tctgcctggaatgcaggagacctgggttcgatccctgagtcaggaagatcccctggagaa 91718 Query: 376 gggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 || |||||| |||||||||||||||| ||||| |||||| ||| |||||| ||||||||| Sbjct: 91717 ggaaatggcaacccactccagtattcttgcctggagaatcccatggacagaggagcctgg 91658 Query: 436 cgggctacagtcc 448 | ||||||||||| Sbjct: 91657 caggctacagtcc 91645 Score = 107 bits (54), Expect = 6e-21 Identities = 102/118 (86%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||||| ||| ||| ||||| ||||||||||||||||||| Sbjct: 12724 tggtaaagaatccgcctgcaatgcaggagacctgggtttgatccctgggtggggaagatc 12665 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || |||||||| || | |||||||||||||||||| ||||||||||| ||| |||| Sbjct: 12664 acctggagaaggaaaagactacccactccagtattctggcctagagaattccatggac 12607 Score = 103 bits (52), Expect = 1e-19 Identities = 82/92 (89%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||| ||||||||||| ||| ||| ||||||| ||||||||| |||||||||||| Sbjct: 64457 taaagaatccgcctgcaatgcaggagacctgggttcaatccctgggttgggaagatcccc 64516 Query: 369 cggagaagggaatggctacccactccagtatt 400 |||||| ||| ||||||||||||||||||| Sbjct: 64517 tggagaaaagaaaggctacccactccagtatt 64548 Score = 103 bits (52), Expect = 1e-19 Identities = 101/116 (87%), Gaps = 1/116 (0%) Strand = Plus / Plus Query: 320 cctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggga 379 |||||||||| ||| || |||||| ||||||||| ||||||| |||| |||||||||| Sbjct: 45391 cctgcaatgcaggagactggggttcgatccctgggttgggaaga-cccctggagaaggga 45449 Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 ||||||||||||||||||||| |||||||||||| ||| ||||| ||||||||| Sbjct: 45450 atggctacccactccagtatttctgcctagagaatcccatggacaaaggagcctgg 45505 Score = 99.6 bits (50), Expect = 2e-18 Identities = 119/142 (83%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||| |||||||||||||| ||| ||| ||||||| ||||||||| |||||||||| Sbjct: 84722 ggtaaaggctctgcctgcaatgcaggagacctgggttcaatccctgggttgggaagatcc 84663 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || | || ||||||| |||| | ||| ||||||| ||||| |||||| ||| ||| | Sbjct: 84662 cctgaaggagggaatagctatgctctctagtattcttgcctggagaattccatggataaa 84603 Query: 427 ggagcctggcgggctacagtcc 448 |||||||||||||||| ||||| Sbjct: 84602 ggagcctggcgggctaaagtcc 84581 Score = 93.7 bits (47), Expect = 1e-16 Identities = 87/99 (87%), Gaps = 1/99 (1%) Strand = Plus / Minus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| |||||||||||| |||||||| |||||| |||||||||||||||| ||||| Sbjct: 18987 ctgggtcgggaagatcccc-ggagaaggaaatggcaacccactccagtattcttgcctga 18929 Query: 410 agaataccacggacaggggagcctggcgggctacagtcc 448 ||||| ||| |||| | ||||||||| |||||||||||| Sbjct: 18928 agaatcccatggacggaggagcctggtgggctacagtcc 18890 Score = 87.7 bits (44), Expect = 6e-15 Identities = 123/147 (83%), Gaps = 3/147 (2%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggt-tcagtccct--gggtggggaa 361 |||||||||||||||||||||| || ||| ||||||| ||| | || |||| ||||| Sbjct: 81346 atggtaaagaatctgcctgcaaagcaggagacccggggctcaattcccaggggttgggaa 81287 Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||| | | |||||| |||||||||||||||| || ||||| ||||| |||||| ||| || Sbjct: 81286 gattctctggagaaaggaatggctacccactgcaatattcttgcctggagaatcccatgg 81227 Query: 422 acaggggagcctggcgggctacagtcc 448 |||| |||||||||| |||||| |||| Sbjct: 81226 acagaggagcctggcaggctactgtcc 81200 Score = 85.7 bits (43), Expect = 2e-14 Identities = 104/123 (84%), Gaps = 1/123 (0%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatgg-ctacccactccagtattcatgcctagagaata 415 |||||||||||| | |||||| ||||| | |||||||||||||||| ||||| |||||| Sbjct: 75451 gggaagatcccctgaagaaggaaatgggcaacccactccagtattcttgcctggagaatc 75392 Query: 416 ccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaac 475 ||| |||| | ||||||||| |||||||||||| ||||| ||||||| |||||| || Sbjct: 75391 ccatggacggaggagcctggtgggctacagtccacagggtcacaaagagtcggatacgac 75332 Query: 476 tga 478 ||| Sbjct: 75331 tga 75329 Score = 81.8 bits (41), Expect = 4e-13 Identities = 56/61 (91%) Strand = Plus / Minus Query: 388 ccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtc 447 |||||||||||||| ||||| |||||| ||| |||||| ||||||||||||||||||||| Sbjct: 92587 ccactccagtattcttgcctggagaatcccatggacagaggagcctggcgggctacagtc 92528 Query: 448 c 448 | Sbjct: 92527 c 92527 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 1528 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccatggacagagga 1587 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 1588 gcctggtgggct 1599 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||| || ||| ||| |||||||||| |||| | ||||||||| Sbjct: 47408 tggtaaagaatcctcctgcactgtgggagacctgggttcagtctctggattgggaagatc 47349 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | ||||||| ||| |||||||||||||||||||| Sbjct: 47348 ctctggagaagagaaaggctacccactccagtattc 47313 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 68420 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 68479 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||| | | ||||| ||| ||||||||||||||| Sbjct: 68480 gcctggtgggctgccgtctatggggtcgcacagagtcggacacaactgaagcgact 68535 Score = 77.8 bits (39), Expect = 6e-12 Identities = 114/139 (82%) Strand = Plus / Plus Query: 331 ggaaacccgggttcagtccctgggtggggaagatcccccggagaagggaatggctaccca 390 ||||||| |||||||||||||||| ||| ||||||| |||||||| |||||| ||||| Sbjct: 64671 ggaaacctgggttcagtccctgggctggggagatcccttggagaaggaaatggcaaccca 64730 Query: 391 ctccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtccct 450 |||||||| || ||||| || ||| ||| ||| | | |||||||| |||||| |||| | Sbjct: 64731 ctccagtactcctgcctggaaaatcccatggatggagtagcctggcaggctactgtccat 64790 Query: 451 agggttgaaaagagttgga 469 |||| ||||||||||| Sbjct: 64791 ggggtcacaaagagttgga 64809 Score = 77.8 bits (39), Expect = 6e-12 Identities = 111/135 (82%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||| |||||||||| | || |||| |||||| |||||| || ||||||||||| Sbjct: 87236 aaagaacctgcctgcaacacatgagacccaggttcaatccctgagtcaggaagatcccct 87177 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||| |||| ||||||| ||||| |||||| ||| ||| || ||| Sbjct: 87176 ggagaaggaaatggcaaccaactctagtattcttgcctggagaatcccatggatagagga 87117 Query: 430 gcctggcgggctaca 444 | |||| |||||||| Sbjct: 87116 ggctggtgggctaca 87102 Score = 75.8 bits (38), Expect = 2e-11 Identities = 86/102 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| | ||| ||||||||||||||| |||| Sbjct: 21769 tccctgggtcgggaagatcccctggaggagggcaaggcagcccactccagtattcctgcc 21828 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | ||||| ||| |||||| ||||||| | |||| ||||||| Sbjct: 21829 tgcagaatcccatggacagaggagcctagtgggccacagtcc 21870 Score = 75.8 bits (38), Expect = 2e-11 Identities = 113/138 (81%) Strand = Plus / Minus Query: 311 aagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccg 370 |||||||||||||| || | ||| ||| |||||| ||||||||| |||||| ||| | | Sbjct: 24861 aagaatctgcctgcgatacaggagaccagggttcgatccctgggttgggaagttcctctg 24802 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 || |||||| || | | || ||||||||||| |||| ||||||| ||| |||||| | || Sbjct: 24801 gaaaagggagtgtcaatccgctccagtattcttgcccagagaattccatggacagagaag 24742 Query: 431 cctggcgggctacagtcc 448 ||||| ||||| |||||| Sbjct: 24741 cctggtgggctgcagtcc 24724 Score = 75.8 bits (38), Expect = 2e-11 Identities = 86/102 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||| |||| ||||| |||||||||||||| | || | Sbjct: 60882 tccctgggtcaggaagatcccctggaggagggcatggcaacccactccagtatccttgtc 60941 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | ||| || ||| |||||| ||||||||| |||||| ||||| Sbjct: 60942 tggaggatcccatggacagaggagcctggtgggctagagtcc 60983 Score = 73.8 bits (37), Expect = 9e-11 Identities = 65/73 (89%), Gaps = 1/73 (1%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca-gggg 428 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||||| |||| Sbjct: 92979 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacaggggg 92920 Query: 429 agcctggcgggct 441 ||||||||||||| Sbjct: 92919 agcctggcgggct 92907 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| |||| |||| | ||||||| |||||||| Sbjct: 99445 tggtaaagaatctgcctgcaatgcaggagacccaggtttgattcctgggttgggaagatg 99386 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | |||||||||| |||||| ||||||||||||| Sbjct: 99385 tgctggagaagggataggctactcactccagtattc 99350 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 3067 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 3008 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 3007 gcctggtgggct 2996 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| || ||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 40268 ggagaaggaaatggcaactcactccagtgttcttgcctggagaatcccagggacagggga 40209 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 40208 gcctggtgggct 40197 Score = 71.9 bits (36), Expect = 4e-10 Identities = 96/116 (82%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||| | |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 83669 ggagaaggaaatgacaacccactccagtgttcttgcctggagaatcccagggacggagga 83728 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||||| | ||||||||| || |||||||||||| Sbjct: 83729 gcctggtgggctgccgtctatggggttgcacagagttggacacgactgaagcgact 83784 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| ||| | | ||| ||||| | |||||| ||||||||| Sbjct: 12842 tggtaaagaatctgcctgcattgcagaagcccctggttcgattcctgggctgggaagatc 12783 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||||||| |||||||||| ||||||||| Sbjct: 12782 ccctggagaagggataggctacccaccccagtattc 12747 Score = 69.9 bits (35), Expect = 1e-09 Identities = 89/107 (83%) Strand = Plus / Plus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| |||||||||||| ||| ||||| |||||| ||| |||||| ||||||||| || Sbjct: 97664 aatggcaacccactccagtgttcttgcctggagaatcccatggacagaggagcctggtgg 97723 Query: 439 gctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 ||| | ||| | |||| | | ||||||||| || |||||||||||| Sbjct: 97724 gctgctgtctatggggtcgcacagagttggacacgactgaagcgact 97770 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 |||| |||||| ||||||||||| |||||||||||||||||||| |||| |||||| || Sbjct: 99265 ggaaaatcccctggagaagggaaaggctacccactccagtattctggcctggagaattcc 99206 Query: 418 acggac 423 | |||| Sbjct: 99205 atggac 99200 Score = 63.9 bits (32), Expect = 9e-08 Identities = 71/84 (84%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||| ||| |||| ||| |||||| | |||||||||||||| | |||||| ||| || Sbjct: 91315 ggaagatgccctggaggaggaaatggcaatccactccagtattctttcctagaaaatccc 91374 Query: 418 acggacaggggagcctggcgggct 441 | |||||| ||||||||| ||||| Sbjct: 91375 aaggacagaggagcctggtgggct 91398 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| || ||||| |||||| ||| |||| ||||| Sbjct: 65918 ggagaaggaaatggcaacccactccagtgtttttgcctggagaatcccagggacggggga 65859 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 65858 gcctggtgggct 65847 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||| | Sbjct: 9275 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggaa 9334 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 9335 gcctggtgggct 9346 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 35798 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggcgga 35739 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 35738 gcctggtgggct 35727 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 49388 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 49329 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 49328 gcctggtgggct 49317 Score = 63.9 bits (32), Expect = 9e-08 Identities = 116/143 (81%), Gaps = 2/143 (1%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||| ||| || ||| ||| |||||| || |||||| ||||||| || Sbjct: 64217 gtaaagaatctgccggcagtgtgggagacctgggttcgatcactgggttgggaagagtcc 64276 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat--accacggacag 425 | |||| | || ||||| |||||||||||||||| | ||| |||||| ||| |||||| Sbjct: 64277 ctggaggacggcatggcaacccactccagtattcttacctggagaatcccccatggacag 64336 Query: 426 gggagcctggcgggctacagtcc 448 ||||||||| ||||||||||| Sbjct: 64337 aggagcctggttggctacagtcc 64359 Score = 60.0 bits (30), Expect = 1e-06 Identities = 90/110 (81%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 |||||||||| ||||| || ||||| ||| ||| |||| ||||| ||||||| ||||| Sbjct: 10000 gggttcagtctttgggtcggaaagatgccctggaagaggggatggcaacccactgcagta 9941 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 | ||||| |||||| ||| ||||||||||| |||| | |||||||||| Sbjct: 9940 tctttgcctggagaatcccatggacaggggagactggtgagctacagtcc 9891 Score = 60.0 bits (30), Expect = 1e-06 Identities = 54/62 (87%) Strand = Plus / Plus Query: 387 cccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagt 446 |||||||||||| || ||||| | ||| |||||||||| ||||||||| |||||||||| Sbjct: 65066 cccactccagtactcttgcctgggaaatcccacggacagaggagcctggtgggctacagt 65125 Query: 447 cc 448 || Sbjct: 65126 cc 65127 Score = 58.0 bits (29), Expect = 5e-06 Identities = 47/53 (88%) Strand = Plus / Plus Query: 390 actccagtattcatgcctagagaataccacggacaggggagcctggcgggcta 442 |||||||||||| |||||||| ||| ||| |||||| |||||||||| ||||| Sbjct: 98152 actccagtattcttgcctagacaatcccatggacagaggagcctggcaggcta 98204 >gb|CM000179| Bos taurus chromosome 3-FRAG[88110000,88209999] Length = 100000 Score = 186 bits (94), Expect = 9e-45 Identities = 142/158 (89%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||||||| ||| |||||| |||| ||||||||||||||||| Sbjct: 74376 gtaaagaatctgcctgcaatgctggagacctgggttctgtccttgggtggggaagatccc 74435 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||||||||||||||||||| ||| |||| | ||| |||||| ||| |||||| | Sbjct: 74436 ctggagaagggaatggctacccacttcagaattcttccctggagaattccatggacagag 74495 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagt 465 |||||||||||||||| |||| |||||||| ||||||| Sbjct: 74496 gagcctggcgggctaccgtccatagggttgcaaagagt 74533 Score = 137 bits (69), Expect = 7e-30 Identities = 144/169 (85%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||| |||| ||| ||| ||||||| ||||| ||| | ||||||| Sbjct: 88908 tggtaaagaatctgcctgccatgcgggagacctgggttcaatccctaggttgagaagatc 88849 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||||||||||||||||||||||||||| ||||| ||||| ||| |||||| Sbjct: 88848 ccctggagaagggaatggctacccactccagtattcttgcctgtagaattccatggacag 88789 Query: 426 gggagcctggcgggctacagtccctagggttgaaaagagttggatacaa 474 ||||| || | |||||||| || | |||| ||||||||||| |||| Sbjct: 88788 aggagcgtgacaggctacagaccatggggtcccaaagagttggacacaa 88740 Score = 127 bits (64), Expect = 7e-27 Identities = 124/144 (86%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| ||||| ||||||||| |||||||| Sbjct: 64985 atggtaaagaatctgcctgcaatgcaggagacctgggttagatccctgggttgggaagat 64926 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| | || ||| ||||| | ||||||||||||| ||||| |||||| ||| ||||| Sbjct: 64925 cccctgaaggaggccatggcaaaccactccagtatttttgcctggagaatcccatggaca 64866 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||||||||||||||| Sbjct: 64865 gaggagcctggcgggctacagtcc 64842 Score = 121 bits (61), Expect = 4e-25 Identities = 97/109 (88%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||||| ||||||||||||||||||||||| ||| |||| | ||| |||||| | Sbjct: 64536 gggaagatcccctggagaagggaatggctacccacttcagaattcttccctggagaattc 64595 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 || |||||| ||||||||||||||||| |||| |||||||| ||||||| Sbjct: 64596 catggacagaggagcctggcgggctaccgtccatagggttgcaaagagt 64644 Score = 119 bits (60), Expect = 2e-24 Identities = 123/144 (85%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||| ||||||||||| ||| ||| ||||| ||||||||| |||||||| Sbjct: 74874 atggtaaagaatccgcctgcaatgcaggagacctgggttagatccctgggttgggaagat 74815 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| | || ||| ||||| | ||||||||||||| ||||| |||||| ||| ||||| Sbjct: 74814 cccctgaaggaggccatggcaaaccactccagtatttttgcctggagaatcccatggaca 74755 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||||||||||||||| Sbjct: 74754 gaggagcctggcgggctacagtcc 74731 Score = 113 bits (57), Expect = 1e-22 Identities = 96/109 (88%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 57856 tggtaaagaatccgcctgcaatgtgggagacctgggttcgatccctgggttgggaagatc 57797 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||| ||||||||||| |||||| ||||||||||||| ||||||||||| Sbjct: 57796 ccctggagaagggaaaggctacacactccagtattctggcctagagaat 57748 Score = 109 bits (55), Expect = 2e-21 Identities = 129/153 (84%), Gaps = 3/153 (1%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||| ||||| |||||||| ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 1809 tggtaaagagtctgcatgcaatgcaggagacctgggttcaatccctgggttgggaagatc 1750 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaatac---cacgga 422 ||| |||||||| |||||| | |||||||||||||| | ||| |||||| | || ||| Sbjct: 1749 ccctggagaaggaaatggcaatccactccagtattctttcctggagaattctttcatgga 1690 Query: 423 caggggagcctggcgggctacagtccctagggt 455 || ||||||||| ||||||| |||| |||||| Sbjct: 1689 aagaggagcctggtgggctaccgtccatagggt 1657 Score = 97.6 bits (49), Expect = 6e-18 Identities = 109/129 (84%) Strand = Plus / Minus Query: 320 cctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggga 379 ||||| |||| ||| |||| |||||||||||||||| | |||||||| | |||||||||| Sbjct: 54426 cctgccatgcaggagacccaggttcagtccctgggttgagaagatcctctggagaaggga 54367 Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcggg 439 |||| || ||||||||||||| || || |||| | ||| |||||| ||||||||| ||| Sbjct: 54366 atggtaacacactccagtattcttgtctggagagttccatggacagaggagcctggtggg 54307 Query: 440 ctacagtcc 448 || |||||| Sbjct: 54306 ctgcagtcc 54298 Score = 93.7 bits (47), Expect = 1e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||| |||| | ||| |||||||||||||||| |||| Sbjct: 70619 tccctgggtcaggaagatcccctggaggagggcacggcaacccactccagtattcttgcc 70678 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||||| ||| |||||| |||||||| |||||||||| | |||||||| ||||||| Sbjct: 70679 tgcagaatcccatggacagaggagcctgatgggctacagttcatagggttgcaaagagt 70737 Score = 91.7 bits (46), Expect = 4e-16 Identities = 113/134 (84%), Gaps = 1/134 (0%) Strand = Plus / Minus Query: 310 aaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||| ||||| ||| || | | |||||||||| ||| |||||||||||| Sbjct: 27157 aaagaatctgcctgccaatgcaggagacactgattcagtccctaggttgggaagatcccc 27098 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||||||| |||||| |||||||| ||||||| || || | ||| ||| |||||| || Sbjct: 27097 tggagaaggaaatggcaacccactctagtattcttgactgggaaatcccatggacagagg 27038 Query: 429 agcctggcgggcta 442 ||||||| |||||| Sbjct: 27037 agcctggtgggcta 27024 Score = 89.7 bits (45), Expect = 2e-15 Identities = 99/117 (84%) Strand = Plus / Plus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| |||| |||||||||| |||||| |||| |||| ||||| |||||| ||| || Sbjct: 65474 gatcccctggaggagggaatggcaacccacaccagaattcttgcctggagaattccatgg 65533 Query: 422 acaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 ||| || |||||| ||||| |||||| |||||| | ||||||||||| |||||||| Sbjct: 65534 acacaggggcctggagggctgcagtccatagggtcgcaaagagttggacacaactga 65590 Score = 87.7 bits (44), Expect = 6e-15 Identities = 113/136 (83%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 |||||| ||||||| ||||| ||| || ||||||| ||||||||| |||||||||||| Sbjct: 55366 taaagagtctgcctataatgcaggagacttgggttcaatccctgggttgggaagatcccc 55307 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||||||| ||||| |||||||||||||||| ||||| | ||| ||| |||||| || Sbjct: 55306 tggagaaggacatggcgacccactccagtattcttgcctgggaaatcccatggacagagg 55247 Query: 429 agcctggcgggctaca 444 | |||| |||||||| Sbjct: 55246 atactggtgggctaca 55231 Score = 85.7 bits (43), Expect = 2e-14 Identities = 88/103 (85%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||| |||||||||| ||| ||| ||||| ||||||||| |||||||| Sbjct: 2906 atggtaaagaatccacctgcaatgcgggagacctgggtttgatccctgggttgggaagat 2965 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcct 407 |||| |||| |||| ||||| |||||||| ||||||| ||||| Sbjct: 2966 cccctggaggagggcatggcaacccactcaagtattcttgcct 3008 Score = 85.7 bits (43), Expect = 2e-14 Identities = 70/79 (88%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||||| ||| |||| |||||| ||||||||| ||||||||| Sbjct: 11753 tggtaaagaatcggcctgcaatgcaggagacccaggttcaatccctgggttgggaagatc 11694 Query: 366 ccccggagaagggaatggc 384 || |||||||| |||||| Sbjct: 11693 tcctggagaaggaaatggc 11675 Score = 81.8 bits (41), Expect = 4e-13 Identities = 113/137 (82%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| ||||||||| ||| |||| |||||| ||||||||| || ||||| Sbjct: 88049 atggtaaagaattcgcctgcaatatgggatacccaggttcaatccctgggttggtaagat 87990 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||| |||| ||||| ||| |||||| ||||| ||||| ||||| ||| ||||| Sbjct: 87989 cccatggaggagggcatggcaacctactccattattcctgcctggagaactccatggaca 87930 Query: 425 ggggagcctggcgggct 441 | ||||||||| ||||| Sbjct: 87929 gaggagcctggtgggct 87913 Score = 81.8 bits (41), Expect = 4e-13 Identities = 111/133 (83%), Gaps = 1/133 (0%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| | |||||||| || ||||| |||||| |||||||||| ||||| |||| Sbjct: 13411 tccctgggttagtaagatcccatggtgaaggaaatggcaacccactccactattcttgcc 13352 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | || ||| ||| | |||| ||||||||| |||||||||||| || ||||| |||||||| Sbjct: 13351 tggaaaatcccatgaacagaggagcctggtgggctacagtccata-ggttgcaaagagtt 13293 Query: 467 ggatacaactgaa 479 ||| | ||||||| Sbjct: 13292 ggacataactgaa 13280 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||| |||||||||||||||| |||||||| ||| | ||||||| |||||||| Sbjct: 42875 tggtaaataatctgcctgcaatgcaggaaaccccagtttgattcctgggtcaggaagatc 42934 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||||||| ||||||||| |||||||||| Sbjct: 42935 ccctggagaagggataggctacccattccagtattc 42970 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 37305 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 37246 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| |||||| | | ||||| ||| ||||||||||||||| Sbjct: 37245 gcctggtgggctgccgtctatagggtcgcacagagtcggacacaactgaagcgact 37190 Score = 77.8 bits (39), Expect = 6e-12 Identities = 75/87 (86%) Strand = Plus / Minus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| |||||||| |||||| |||||||||||| || ||||| || ||| ||| || Sbjct: 69383 gatcccctggagaaggaaatggcaacccactccagtgtttttgcctggaaaatcccatgg 69324 Query: 422 acaggggagcctggcgggctacagtcc 448 |||| ||||||||| |||||||||||| Sbjct: 69323 acagaggagcctggtgggctacagtcc 69297 Score = 77.8 bits (39), Expect = 6e-12 Identities = 63/71 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 81299 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 81240 Query: 430 gcctggcgggc 440 |||||| |||| Sbjct: 81239 gcctggtgggc 81229 Score = 77.8 bits (39), Expect = 6e-12 Identities = 114/139 (82%) Strand = Plus / Plus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||| |||||||||| ||| ||| ||||| ||||||||| ||||| || ||| Sbjct: 36691 aaagaatccgcctgcaatgtgggagacctcggttccatccctgggttgggaaaatgccct 36750 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||| |||| ||||||||||||| ||| |||||| ||||||| || ||| Sbjct: 36751 ggagaaggaaatgactactcactccagtattctgacctggagaattccacggatagagga 36810 Query: 430 gcctggcgggctacagtcc 448 ||||| ||||||||||| Sbjct: 36811 agctggcaggctacagtcc 36829 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||| |||||| ||| ||||| |||||||||| |||| ||||| Sbjct: 13681 ggagaaggaaatggcaacccattccagtgttcttgcctggagaataccatggacggggga 13740 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 13741 gcctggtgggct 13752 Score = 71.9 bits (36), Expect = 4e-10 Identities = 60/68 (88%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| |||||| || |||||||||||| |||| |||| ||||| |||||||||||||| Sbjct: 20670 ggttcaatccctgagtcgggaagatcccctggaggagggcatggcaacccactccagtat 20611 Query: 400 tcatgcct 407 || ||||| Sbjct: 20610 tcttgcct 20603 Score = 69.9 bits (35), Expect = 1e-09 Identities = 75/87 (86%), Gaps = 1/87 (1%) Strand = Plus / Minus Query: 352 gggtggggaagatcccccggagaagggaa-tggctacccactccagtattcatgcctaga 410 |||| |||||||||||| ||||||| ||| ||||||||| ||||||||||| ||||| || Sbjct: 93894 gggtcgggaagatcccctggagaagagaaatggctaccctctccagtattcttgcctgga 93835 Query: 411 gaataccacggacaggggagcctggcg 437 |||| || ||| || ||||||||||| Sbjct: 93834 gaatcccgtggagagaggagcctggcg 93808 Score = 63.9 bits (32), Expect = 9e-08 Identities = 105/128 (82%), Gaps = 1/128 (0%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| |||||||| |||||| | || |||| ||| ||||| |||| |||||||| Sbjct: 61960 gggttcaacccctgggtcaggaagacctcctggagtaggacatggcaaccccctccagta 62019 Query: 399 ttcatgcctagagaatacc-acggacaggggagcctggcgggctacagtccctagggttg 457 ||| ||||| |||||| || || || || |||||||||||||||||| ||| ||| |||| Sbjct: 62020 ttcttgcctggagaatccccacagatagaggagcctggcgggctacaatccttagtgttg 62079 Query: 458 aaaagagt 465 ||||||| Sbjct: 62080 caaagagt 62087 Score = 63.9 bits (32), Expect = 9e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||| ||| Sbjct: 16682 ggagaaggaaatggcaacccactccagtcttcttgcctggagaatcccagggacagagga 16741 Query: 430 gcct 433 |||| Sbjct: 16742 gcct 16745 Score = 61.9 bits (31), Expect = 3e-07 Identities = 95/115 (82%), Gaps = 1/115 (0%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||| |||| |||| |||| ||||| | |||||||||||||| ||||| Sbjct: 43024 cctgggttgggaagaccccctggaggagggcatggcaatccactccagtattcttgcctg 43083 Query: 409 gagaat-accacggacaggggagcctggcgggctacagtccctagggttgaaaag 462 || ||| || |||||| ||||||||| ||| |||||||| | |||||| |||| Sbjct: 43084 gataatccccgtggacagaggagcctggtggggtacagtccatggggttgcaaag 43138 Score = 61.9 bits (31), Expect = 3e-07 Identities = 61/71 (85%) Strand = Plus / Plus Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| |||||| Sbjct: 33721 gagaaggcaatggcaacccactccagtgttcttgcctggagaatcccagggatgggggag 33780 Query: 431 cctggcgggct 441 ||||| ||||| Sbjct: 33781 cctggtgggct 33791 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||| || |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 52179 ggagaaggaaatagcaacccactccagtgttcttgcctggagaatcccagggacggggga 52120 Query: 430 gcctgg 435 |||||| Sbjct: 52119 gcctgg 52114 Score = 60.0 bits (30), Expect = 1e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||| |||||||||||||||| ||| ||| | |||| | ||||||| ||||||||| Sbjct: 44590 tggtaaataatctgcctgcaatgcaggagaccttgattcaattcctgggttgggaagatc 44649 Query: 366 ccccggagaaggga 379 ||| ||| |||||| Sbjct: 44650 ccctggaaaaggga 44663 Score = 58.0 bits (29), Expect = 5e-06 Identities = 82/97 (84%), Gaps = 2/97 (2%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| || ||| || ||| | ||||||| ||||| || Sbjct: 89027 tggtaaagaatctgcctgcaatgcaagagaccgtgggtcaattcctgggtcaggaagttc 88968 Query: 366 ccccggagaagggaat-ggctacccactccagtattc 401 ||| |||| ||||||| |||||||||| ||||||||| Sbjct: 88967 ccctggag-agggaataggctacccacgccagtattc 88932 Score = 58.0 bits (29), Expect = 5e-06 Identities = 94/113 (83%), Gaps = 2/113 (1%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaa-tac 416 ||||||||||| |||| || | |||| ||||| |||||||||| ||||| ||||| | | Sbjct: 34375 ggaagatcccctggagtgggaagtggcaacccattccagtattcttgcct-gagaaatcc 34317 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 || |||||| |||||||||| ||||||||||| | |||| | || |||||||| Sbjct: 34316 catggacagaggagcctggcaggctacagtccatggggtagcaaggagttgga 34264 >gb|CM000202| Bos taurus chromosome 26-FRAG[32040000,32139999] Length = 100000 Score = 186 bits (94), Expect = 9e-45 Identities = 157/178 (88%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| |||| |||||||| || |||| |||||||||| Sbjct: 45576 gtaaagaatctgcctgcaatgcaggagacccaggttcagttccagggtcaggaagatccc 45635 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||||||||||||||||||||||||||| ||||| |||||| ||| |||||| | Sbjct: 45636 ctggagaagggaatggctacccactccagtattcttgcctggagaatcccatggacagag 45695 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 ||||||||| ||||||||||| |||||||| | ||||| || || |||||||||||| Sbjct: 45696 gagcctggctggctacagtccgtagggttgcagagagtcagacacgactgaagcgact 45753 Score = 119 bits (60), Expect = 2e-24 Identities = 117/136 (86%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| ||| |||||| |||||| ||||||||| ||||||||| Sbjct: 36451 tggtaaagaatctgcctgcagtgcaggaaactggggttcgatccctgggttgggaagatc 36392 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||| |||||| |||||||||||||| | ||||| || ||| || |||||| Sbjct: 36391 ccctggagaaggaaatggcaacccactccagtatccttgcctggaaaatcgcatggacag 36332 Query: 426 gggagcctggcgggct 441 ||||||||| ||||| Sbjct: 36331 aggagcctggtgggct 36316 Score = 113 bits (57), Expect = 1e-22 Identities = 111/129 (86%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||||| ||||||| | ||||| |||| ||||||||||| |||||||||||| | Sbjct: 2585 gggaagatcccctggagaagagcatggcaaccctctccagtattcttgcctagagaatcc 2526 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaact 476 || |||||| |||||||||||||||||||||| | | || ||||||||||| |||||| Sbjct: 2525 caaggacagaggagcctggcgggctacagtccatggcgtcacaaagagttggacacaact 2466 Query: 477 gaagcgact 485 ||| |||| Sbjct: 2465 taagtgact 2457 Score = 107 bits (54), Expect = 6e-21 Identities = 105/122 (86%) Strand = Plus / Plus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| ||||||||||| | || ||| |||||| |||||||||||||||| ||||| Sbjct: 36942 ccctgggtcaggaagatcccctgcaggaggaaatggcaacccactccagtattcttgcct 37001 Query: 408 agagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttg 467 ||||||| ||| |||||| ||||||||| |||||||||||| ||||| ||||||||| Sbjct: 37002 agagaattccatggacagaggagcctggagggctacagtccacagggtcacaaagagttg 37061 Query: 468 ga 469 || Sbjct: 37062 ga 37063 Score = 105 bits (53), Expect = 3e-20 Identities = 122/144 (84%), Gaps = 7/144 (4%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||||||||| ||| ||| ||||||| ||||||||| |||||||| Sbjct: 89436 atggtaaagaatctgcctgcaatgtgggagaccagggttcaatccctgggttgggaagat 89377 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| | ||||||||||||||||| ||| |||||| ||| || || Sbjct: 89376 cccctggagaaggtca-ggctacccactccagta------cctggagaattccatgggca 89324 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||| ||||||||||| Sbjct: 89323 gaggagcctggcaggctacagtcc 89300 Score = 103 bits (52), Expect = 1e-19 Identities = 117/138 (84%), Gaps = 3/138 (2%) Strand = Plus / Plus Query: 351 tgggtggggaagatcccccggagaaggga---atggctacccactccagtattcatgcct 407 |||||||||| ||||||| |||| |||| ||||| |||||||||||| ||| ||||| Sbjct: 35179 tgggtggggatgatcccctggaggaggggggcatggcaacccactccagtgttcttgcct 35238 Query: 408 agagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttg 467 |||||| ||| |||||| ||||||||| |||||||||||| |||||| | ||||||| | Sbjct: 35239 ggagaatgccatggacagaggagcctggtgggctacagtccatagggtcgcaaagagtcg 35298 Query: 468 gatacaactgaagcgact 485 || || |||||||||||| Sbjct: 35299 gacacgactgaagcgact 35316 Score = 99.6 bits (50), Expect = 2e-18 Identities = 153/186 (82%), Gaps = 1/186 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||| |||||||||||||||||| || ||| |||||| |||||| | |||| || Sbjct: 49047 atggtagagaatctgcctgcaatgcaggtgacctgggttcgaaccctggatcaggaaaat 49106 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 || | |||||||| |||||| |||||||||| ||||| ||||| |||||| ||| || || Sbjct: 49107 cctctggagaaggaaatggcaacccactccaatattcttgcctggagaatcccatggtca 49166 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | ||||||||| |||||||||||| | |||| |||||| ||| ||||||| |||||| Sbjct: 49167 gaggagcctggtgggctacagtccatggggtcacaaagagccggacacaactg-agcgac 49225 Query: 485 tcacac 490 |||||| Sbjct: 49226 tcacac 49231 Score = 99.6 bits (50), Expect = 2e-18 Identities = 102/118 (86%), Gaps = 1/118 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||||| ||| |||| ||||| | ||||||| ||||||||| Sbjct: 9389 tggtaaagaatc-gcctgcaatgcaggagaccccagttcaattcctgggttgggaagatc 9447 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| |||||| ||||||||||||| |||| |||||| ||| |||| Sbjct: 9448 ccctggagaagggaaaggctactcactccagtattctggcctggagaattccatggac 9505 Score = 95.6 bits (48), Expect = 2e-17 Identities = 99/116 (85%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 ||||||||| ||| || |||||||||||| |||| || | | ||| |||| ||||||||| Sbjct: 57927 ggttcagtctctgagtcgggaagatcccctggaggagagcacggcaaccccctccagtat 57986 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 || ||||| |||||| |||||||| | ||| |||||||||||||||||| |||||| Sbjct: 57987 tcttgcctggagaatcccacggacggaggaacctggcgggctacagtccatagggt 58042 Score = 89.7 bits (45), Expect = 2e-15 Identities = 84/97 (86%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||| |||||| |||| ||| |||||| || ||||||||||||| ||||| Sbjct: 53557 cctgggtcgggaatatcccctggaggaggaaatggcaactcactccagtattcttgcctg 53498 Query: 409 gagaataccacggacaggggagcctggcgggctacag 445 |||||| ||| | ||||||||||||||||||||||| Sbjct: 53497 gagaatcccatcgccaggggagcctggcgggctacag 53461 Score = 85.7 bits (43), Expect = 2e-14 Identities = 116/139 (83%), Gaps = 1/139 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||| | || |||| |||||| ||||||||| ||||||| Sbjct: 5681 tggtaaagaatctgcctgcaatac-agagacccaggttcaatccctgggtcaggaagatg 5739 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 || |||||||| |||||| ||||||| |||||||| ||||| |||||| ||| |||| | Sbjct: 5740 ccttggagaaggaaatggcaacccactgcagtattcttgcctggagaattccatggactg 5799 Query: 426 gggagcctggcgggctaca 444 | ||| |||| ||||||| Sbjct: 5800 agaagcttggcaggctaca 5818 Score = 83.8 bits (42), Expect = 9e-14 Identities = 87/102 (85%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||| ||| |||| ||| |||||| || |||||||| |||| |||| Sbjct: 77833 tccctgggtcaggaagattccctggaggaggaaatggcaactcactccaggattcttgcc 77892 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| || |||||| |||||||||||||||||||||| Sbjct: 77893 tggagaatctcatggacagaggagcctggcgggctacagtcc 77934 Score = 81.8 bits (41), Expect = 4e-13 Identities = 93/109 (85%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||| ||||||| |||| |||| ||||| |||||||||||||||| |||| Sbjct: 40670 tccctgggtcgggaggatcccctggaggagggcatggcaacccactccagtattcttgcc 40729 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 | || | | || || ||| |||||||||||||||||||||| |||||| Sbjct: 40730 tgga-agttccgtgggcagaggagcctggcgggctacagtccatagggt 40777 Score = 77.8 bits (39), Expect = 6e-12 Identities = 93/111 (83%) Strand = Plus / Minus Query: 355 tggggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||| |||| ||| || || ||||| ||||||||||| ||| ||||| |||||| Sbjct: 27621 tggggaagagcccctggaaaaaggcatggcaacccactccagcgttcttgcctggagaat 27562 Query: 415 accacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 ||| |||||| |||||||||| |||| |||||| || ||| ||||||||| Sbjct: 27561 cccatggacagaggagcctggcaggctgcagtccataaggtcgaaaagagt 27511 Score = 73.8 bits (37), Expect = 9e-11 Identities = 73/85 (85%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| ||||||||| || ||||||| ||| |||||||||||||||| Sbjct: 39975 gggttcaatccctgggttgggaagatctcctggagaagagaacagctacccactccagta 40034 Query: 399 ttcatgcctagagaataccacggac 423 ||| |||| |||||| ||| |||| Sbjct: 40035 ttctggcctggagaattccatggac 40059 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 49537 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 49596 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 49597 gcctggtgggct 49608 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 619 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 678 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 679 gcctggtgggct 690 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||||||||| Sbjct: 21342 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagagacagggga 21283 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 21282 gcctggtgggct 21271 Score = 69.9 bits (35), Expect = 1e-09 Identities = 68/79 (86%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| || | ||||| ||||| ||| ||||||||| Sbjct: 62137 tggtaaagaatctgcctgcaatgcaggagacgcaagttcaatccctaggttgggaagatc 62078 Query: 366 ccccggagaagggaatggc 384 ||| |||||| | |||||| Sbjct: 62077 ccctggagaaagaaatggc 62059 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||| |||||| ||||| | |||||||| || || |||| | || Sbjct: 71599 ggaagatcccctggagaaggaaatggcaacccatttcagtattcttgtctggagacttcc 71540 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| |||||||||| || |||||||| Sbjct: 71539 atggacagaggagcctggccggttacagtcc 71509 Score = 65.9 bits (33), Expect = 2e-08 Identities = 82/97 (84%), Gaps = 1/97 (1%) Strand = Plus / Minus Query: 352 gggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctagag 411 |||| ||||||||||| ||||||| || || | |||||||||||||||| ||||| ||| Sbjct: 59416 gggttgggaagatcccttggagaagcgattg-caacccactccagtattcttgcctggag 59358 Query: 412 aataccacggacaggggagcctggcgggctacagtcc 448 ||| ||| ||| || ||||||||| ||||||||||| Sbjct: 59357 aattccatggatagaggagcctggaaggctacagtcc 59321 Score = 63.9 bits (32), Expect = 9e-08 Identities = 80/96 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| ||||| |||||| || ||||||| | ||||| |||||||||||| ||| |||| Sbjct: 60747 tccctgagtgggaaagatcacctggagaagagcatggcgacccactccagttttcttgcc 60688 Query: 407 tagagaataccacggacaggggagcctggcgggcta 442 | || ||| ||| |||||| ||||||| ||||||| Sbjct: 60687 tggataatcccaaggacagaggagcctaacgggcta 60652 Score = 63.9 bits (32), Expect = 9e-08 Identities = 65/76 (85%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||| ||||| || ||||||||| |||||||||| |||| |||||||||||| Sbjct: 1308 gggttcaatccgtgggttggaaagatcccctggagaagggagaggctgcccactccagta 1249 Query: 399 ttcatgcctagagaat 414 ||| |||| |||||| Sbjct: 1248 ttctggcctggagaat 1233 >gb|CM000199| Bos taurus chromosome 23-FRAG[14220000,14319999] Length = 100000 Score = 186 bits (94), Expect = 9e-45 Identities = 154/174 (88%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| ||||||| ||||||||| |||||||| Sbjct: 13495 atggtaaagaatctgcctgcaatgcaggagacctgggttcaatccctgggttgggaagat 13436 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||| ||| |||||| |||||||||||||||| |||||||||||| ||| ||||| Sbjct: 13435 tccctggaggaggaaatggcaacccactccagtattcttgcctagagaattccatggaca 13376 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | |||||||||||||||||||| | | |||||| ||||||| ||| |||||||| Sbjct: 13375 gaggagcctggcgggctacagttcatggggttgcaaagagtcggacacaactga 13322 Score = 129 bits (65), Expect = 2e-27 Identities = 132/153 (86%), Gaps = 1/153 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||||| ||| |||| |||||| ||||||||| ||||||||| Sbjct: 48515 tggtaaagaatccgcctgcaatgcaggagaccctggttcaatccctgggttgggaagatc 48456 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggaca 424 |||||||| |||| ||||| |||||||||||||||| ||||| ||| || ||| ||||| Sbjct: 48455 ccccggaggagggcatggcaacccactccagtattcttgcctggagtatccccatggaca 48396 Query: 425 ggggagcctggcgggctacagtccctagggttg 457 | ||||| ||| ||||||||||| | |||||| Sbjct: 48395 gaggagcatggtaggctacagtccatggggttg 48363 Score = 107 bits (54), Expect = 6e-21 Identities = 126/150 (84%), Gaps = 5/150 (3%) Strand = Plus / Plus Query: 304 aatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaaga 363 |||||||| |||||||||||||||| ||| || | |||||| |||||| || ||||||| Sbjct: 10365 aatggtaatcaatctgcctgcaatgcaggagactcaggttcaatccctgcgttgggaaga 10424 Query: 364 tcccccggagaagggaatgg-----ctacccactccagtattcatgcctagagaatacca 418 | ||| |||||||||||||| ||| |||||||||||||| ||||| ||| || ||| Sbjct: 10425 ttccctggagaagggaatggaatgactagccactccagtattcttgcctggaggattcca 10484 Query: 419 cggacaggggagcctggcgggctacagtcc 448 |||||| ||||||||| |||||||||||| Sbjct: 10485 tggacagaggagcctggtgggctacagtcc 10514 Score = 103 bits (52), Expect = 1e-19 Identities = 109/128 (85%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||||||| ||| ||| ||||| ||| || || |||| ||||||| Sbjct: 55231 taaagaatctgcctgcaatgcaggagacctgggtttgatccttgagttgggaggatcccc 55290 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||||||| |||||| | | |||||||||||| |||||||||||| ||| |||||| || Sbjct: 55291 tggagaaggaaatggcaaactactccagtattcttgcctagagaatcccatggacagagg 55350 Query: 429 agcctggc 436 |||||||| Sbjct: 55351 agcctggc 55358 Score = 99.6 bits (50), Expect = 2e-18 Identities = 89/102 (87%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| ||| |||||| |||||||||||||||| |||| Sbjct: 34328 tccctgggtcgggaagatcccctggagcaggaaatggcaacccactccagtattcttgcc 34269 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| |||||| |||||||||||| ||||||||| Sbjct: 34268 tgggaaatcccatggacagaggagcctggcggcctacagtcc 34227 Score = 93.7 bits (47), Expect = 1e-16 Identities = 90/103 (87%), Gaps = 1/103 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||||||| ||||| ||| |||||||||||| |||| Sbjct: 7395 tccctgggttgggaagatcccctggagaaggtcatggcaacctactccagtattcttgcc 7454 Query: 407 tagagaat-accacggacaggggagcctggcgggctacagtcc 448 | |||||| |||||||||| |||| ||||| ||||||||||| Sbjct: 7455 tggagaatccccacggacagaggaggctggcaggctacagtcc 7497 Score = 91.7 bits (46), Expect = 4e-16 Identities = 88/102 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||| || |||| ||| |||||| |||||||||||||||| |||| Sbjct: 79158 tccctgggtcaggaagatctcctggaggaggaaatggcaacccactccagtattcttgcc 79217 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| |||||| |||||||||||||||||||||| Sbjct: 79218 tgggaaatcccatggacagaggagcctggcgggctacagtcc 79259 Score = 85.7 bits (43), Expect = 2e-14 Identities = 82/95 (86%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||| ||||| || ||| || || ||| ||||||||| ||||||||| Sbjct: 40839 tggtaaagaatctggctgcattgtgggagccctggtttcgatccctgggttgggaagatc 40780 Query: 366 ccccggagaagggaatggctacccactccagtatt 400 ||| ||||||||||| ||||||||||||||||||| Sbjct: 40779 ccctggagaagggaaaggctacccactccagtatt 40745 Score = 83.8 bits (42), Expect = 9e-14 Identities = 99/118 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||| |||| ||| ||| |||||| ||||||||| ||||||| | Sbjct: 25211 tggtaaagaatccgcctgtgatgcgggagacctgggttcgatccctgggttgggaagacc 25270 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || ||||||||||| ||| |||||||||||||||| |||| |||||| ||| |||| Sbjct: 25271 acctggagaagggaaaggcaacccactccagtattctggcctggagaattccagggac 25328 Score = 83.8 bits (42), Expect = 9e-14 Identities = 99/118 (83%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||||||| || ||| |||| ||| |||||| || ||||||| ||| Sbjct: 16641 gtaaagaatctgcctgcaacgcaggagaccctcattcgatccctgagttgggaagacccc 16700 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 | |||||||||||||| |||||| |||||||||| ||||| || ||| ||| |||||| Sbjct: 16701 ctggagaagggaatggttacccattccagtattcttgcctggaaaattccatggacag 16758 Score = 81.8 bits (41), Expect = 4e-13 Identities = 104/125 (83%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| ||| ||||| ||||| |||||| |||| ||| ||||| || ||||| |||||| Sbjct: 85823 gttcaatccttgggtcgggaaaatcccctggaggaggagatggcaactcactctagtatt 85882 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaa 460 | ||||| || ||| |||||||||| ||||||||| |||||||||||| | ||||| || Sbjct: 85883 cttgcctggaaaatcccacggacagaggagcctggtgggctacagtccacaaggttgcaa 85942 Query: 461 agagt 465 ||||| Sbjct: 85943 agagt 85947 Score = 73.8 bits (37), Expect = 9e-11 Identities = 113/137 (82%), Gaps = 1/137 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||| ||| |||||||||||| || | ||| ||||| | ||||| || ||||| |||| Sbjct: 38495 tcccttggtcgggaagatcccctggtggaggacatggcaatccacttcaatattcttgcc 38554 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | ||||| ||| || ||| ||||||||| |||||||||||| |||||| | ||||||| Sbjct: 38555 tggagaac-ccatgggcagaggagcctggtgggctacagtccatagggtcgcaaagagtg 38613 Query: 467 ggatacaactgaagcga 483 ||| ||||||||||||| Sbjct: 38614 ggacacaactgaagcga 38630 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 47972 ggagaaggaaatggcaacccactccagagttcttgcctggagaatcccagggacagggga 47913 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 47912 gcctggtgggct 47901 Score = 71.9 bits (36), Expect = 4e-10 Identities = 97/116 (83%), Gaps = 1/116 (0%) Strand = Plus / Plus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| |||||||||||| |||| ||| |||||| |||||||| ||||||| | ||| | Sbjct: 30460 ctgggttgggaagatcccc-ggaggaggaaatggcaacccactctagtattcttaccttg 30518 Query: 410 agaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 ||| ||| ||||| |||||||||| ||||||||||| | |||||| ||||||| Sbjct: 30519 gaaatcccatggacaaaggagcctggcaggctacagtccatggggttgcaaagagt 30574 Score = 69.9 bits (35), Expect = 1e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 ||||| |||||||||||||| ||| ||||||||||| | |||||||||||||| ||||| Sbjct: 6721 cctggatggggaagatcccctggaaaagggaatggcaatccactccagtattcttgcct 6663 Score = 67.9 bits (34), Expect = 6e-09 Identities = 52/58 (89%) Strand = Plus / Minus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||| || ||||||||| |||||||| |||| | |||||||||||||||||||||| Sbjct: 69090 ctgggttggaaagatcccctggagaaggaaatgacaacccactccagtattcatgcct 69033 Score = 65.9 bits (33), Expect = 2e-08 Identities = 114/141 (80%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| || ||| ||| | |||| |||| ||| | |||||||||||||||| | || Sbjct: 44169 tccctgggtcggaaaggtcctctggaggagggcatgacaacccactccagtattcttccc 44110 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| || |||||| |||| ||||| ||||||||||| | |||| | || |||| Sbjct: 44109 tggagaatcgcaaggacagaggaggctggcaggctacagtccatggggtcgcaaggagtc 44050 Query: 467 ggatacaactgaagcgactca 487 ||| || ||||||| |||||| Sbjct: 44049 ggacacgactgaagtgactca 44029 >gb|CH975134| Bos taurus ChrUn.003.940 genomic scaffold Length = 122865 Score = 184 bits (93), Expect = 3e-44 Identities = 141/157 (89%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||||||| ||| ||||||| ||||||||| |||||||||| Sbjct: 71180 gtaaagaatctgcctgcaatgctggacaccagggttcaatccctgggtctggaagatccc 71121 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||| |||||||||||||||||||||||| |||||||||||| ||| | |||| | Sbjct: 71120 ctggagaagagaatggctacccactccagtattcttgcctagagaatcccatgcacagag 71061 Query: 428 gagcctggcgggctacagtccctagggttgaaaagag 464 ||||||||| ||||||||||| | |||||| |||||| Sbjct: 71060 gagcctggcaggctacagtccatggggttgcaaagag 71024 Score = 115 bits (58), Expect = 3e-23 Identities = 118/138 (85%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| |||||||||| |||| |||| Sbjct: 20332 tccctgggtcgggaagatcccctggaggagggcatggcaacccactccaaaattcttgcc 20391 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| |||||||||| ||||||||||| ||| || | ||||||| Sbjct: 20392 tggagaatcccatggacagaggagcctggcaggctacagtccatagtgtcgcaaagagtc 20451 Query: 467 ggatacaactgaagcgac 484 || |||||||||||||| Sbjct: 20452 agacacaactgaagcgac 20469 Score = 109 bits (55), Expect = 2e-21 Identities = 82/91 (90%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||| ||| ||||||||||||||||| || ||||||| Sbjct: 44735 ggtaaagaatctgcctgcaatgcaggagacctgggttcagtccctgggttggaaagatcc 44676 Query: 367 cccggagaagggaatggctacccactccagt 397 || |||| |||| ||||| |||||||||||| Sbjct: 44675 cctggaggagggcatggcaacccactccagt 44645 Score = 99.6 bits (50), Expect = 2e-18 Identities = 101/118 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||||| ||| | | |||||| ||||||||| ||||||||| Sbjct: 24565 tggtaaagaatccgcctgcaatgcaggagatctgggttcgatccctgggttgggaagatc 24624 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| || ||||||||||||| ||| |||| |||||| ||| |||| Sbjct: 24625 ccctggagaagggaaagggtacccactccagtgttctggcctggagaattccatggac 24682 Score = 93.7 bits (47), Expect = 1e-16 Identities = 104/123 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||| | |||||||| ||| || |||||||||||||||| |||| Sbjct: 51422 tccctgggtcgggaagatccactggagaaggaaatagcaacccactccagtattcttgcc 51481 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | | ||| || |||||| |||||||||||||||||||||| | |||| | |||||| | Sbjct: 51482 tgggaaatctcaaggacagaggagcctggcgggctacagtccatggggtcgcaaagagct 51541 Query: 467 gga 469 ||| Sbjct: 51542 gga 51544 Score = 87.7 bits (44), Expect = 6e-15 Identities = 110/132 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| || ||||||||| ||||||||||||||| ||| ||||||||| || |||| Sbjct: 83444 tccctgggttggcaagatcccctggagaagggaatggcaaccgactccagtagtcttgcc 83385 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | || ||| ||| || ||| ||| ||||| |||||||||||| | ||||| | |||| | Sbjct: 83384 tggaaaatcccatgggcagaggaacctggtgggctacagtccatggggttacatagagct 83325 Query: 467 ggatacaactga 478 ||| |||||||| Sbjct: 83324 ggacacaactga 83313 Score = 87.7 bits (44), Expect = 6e-15 Identities = 98/116 (84%) Strand = Plus / Minus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||||||||||||||| |||| || ||||| |||||||||||||||| ||||| | Sbjct: 111951 ctgggtggggaagatcccttggagtagaagatggcaacccactccagtattcttgccttg 111892 Query: 410 agaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 ||||| ||| ||||| |||||||||| ||||| |||| |||||||| ||||||| Sbjct: 111891 agaattccatagacagaggagcctggcaggctatggtccatagggttgcaaagagt 111836 Score = 83.8 bits (42), Expect = 9e-14 Identities = 117/142 (82%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||| ||||||||| ||| |||| |||| |||||| || |||||||| Sbjct: 91581 atggtaaagaatctgtctgcaatgcaggagacccaggtttgatccctgagttgggaagat 91640 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| || ||||||||||| || |||| |||||||| || || ||||| ||| ||||| Sbjct: 91641 tccctagaaaagggaatggcaactcactgcagtattcttgtctggagaactccatggaca 91700 Query: 425 ggggagcctggcgggctacagt 446 ||||||||||||| |||||| Sbjct: 91701 taggagcctggcgggttacagt 91722 Score = 81.8 bits (41), Expect = 4e-13 Identities = 116/141 (82%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||| | |||||| |||||| || ||||| |||||||| || Sbjct: 15359 gtaaagaatctgcctgcaattcaggaaacttgggttccatctctgggatgggaagattcc 15418 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||| ||| ||||| | |||||||||||||| ||||| |||||| ||| |||||| | Sbjct: 15419 ctggaggaggacatggcaatccactccagtattcttgcctggagaattccatggacagag 15478 Query: 428 gagcctggcgggctacagtcc 448 || |||| ||||||||||| Sbjct: 15479 gattgtggcaggctacagtcc 15499 Score = 75.8 bits (38), Expect = 2e-11 Identities = 77/90 (85%) Strand = Plus / Plus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||||||| |||||| |||||||||||||||| ||||| | ||| ||| Sbjct: 25682 gaagatcccctggagaaggaaatggcaacccactccagtattcttgcctgggaaatccca 25741 Query: 419 cggacaggggagcctggcgggctacagtcc 448 ||||| |||||||||| ||||| ||||| Sbjct: 25742 tggacaaaggagcctggcaggctatagtcc 25771 Score = 69.9 bits (35), Expect = 1e-09 Identities = 80/95 (84%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| ||| |||||| |||||||||||||| |||| Sbjct: 61762 tccctgggtcgggaagatcccctggaggaggaaatggcattccactccagtattcttgcc 61703 Query: 407 tagagaataccacggacaggggagcctggcgggct 441 | | ||| ||| |||||| |||||||||| |||| Sbjct: 61702 tgggaaatcccaaggacagaggagcctggcaggct 61668 Score = 67.9 bits (34), Expect = 6e-09 Identities = 79/94 (84%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||| ||||||||||| ||||| || ||||| | ||||||| ||||||||| Sbjct: 24448 gtaaagaatccgcctgcaatgcgggaaatcccggttcgattcctgggtcgggaagatctg 24507 Query: 368 ccggagaagggaatggctacccactccagtattc 401 | |||||||||| |||||||||| |||||||| Sbjct: 24508 ctggagaagggatgggctacccacatcagtattc 24541 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||| | |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 18307 ggagaaggaaatgacaacccactccagtgttcttgcctggagaatcccagggactgggga 18366 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 18367 gcctggtgggct 18378 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| |||| Sbjct: 80732 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacgaggga 80673 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 80672 gcctggtgggct 80661 Score = 60.0 bits (30), Expect = 1e-06 Identities = 60/70 (85%) Strand = Plus / Minus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| |||||| Sbjct: 80085 agaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacgagggagc 80026 Query: 432 ctggcgggct 441 |||| ||||| Sbjct: 80025 ctggtgggct 80016 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||||||||||| |||||||||||| ||| ||||| |||||| ||| ||| | ||| Sbjct: 97125 ggagaagggaatggcaacccactccagtgttcttgcctggagaatcccagggatggtgga 97066 Query: 430 gcctgg 435 |||||| Sbjct: 97065 gcctgg 97060 >gb|CM000185| Bos taurus chromosome 9-FRAG[15390000,15489999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 147/165 (89%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||| |||||||||||||||| ||| |||| |||||| ||||||||| |||||||| Sbjct: 45575 atggtaaataatctgcctgcaatgcaggagacccaggttcaatccctgggtcgggaagat 45634 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 || | ||||||| ||||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 45635 cctctggagaagagaatggcaacccactccagtattcttgcctggagaattccatggaca 45694 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | ||||||||| |||||||||||| |||||||| ||||||||||| Sbjct: 45695 gaggagcctggtgggctacagtccatagggttgcaaagagttgga 45739 Score = 157 bits (79), Expect = 8e-36 Identities = 151/175 (86%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||| ||| |||||| ||||| |||||||||||||| Sbjct: 19221 ggtaaagaatctgcctgcaatgcgggagacctgggttccatccctaggtggggaagatcc 19162 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 | ||||||||||||||| |||||||||||||||| || || |||||| ||| |||||| Sbjct: 19161 actggagaagggaatggcaacccactccagtattcttgactggagaatcccatggacaga 19102 Query: 427 ggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagc 481 |||||||||| ||||||||||| | |||| ||||||| || ||||||||||| Sbjct: 19101 ggagcctggcaggctacagtccatggggtcataaagagtcagacacaactgaagc 19047 Score = 127 bits (64), Expect = 7e-27 Identities = 109/124 (87%) Strand = Plus / Minus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| |||||||||||| ||| |||||||||||||||||||||||||||| Sbjct: 30384 ttcaatccctgggtcgggaagatcccctggaaaagggaatggctacccactccagtattc 30325 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaa 461 ||||| |||||| ||| |||||| ||| ||||| |||| ||||||| | |||| ||||| Sbjct: 30324 ttgcctggagaatcccatggacagaggaacctggtgggccacagtccatggggtcgaaaa 30265 Query: 462 gagt 465 |||| Sbjct: 30264 gagt 30261 Score = 109 bits (55), Expect = 2e-21 Identities = 106/123 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||| |||||||||||| |||||||| |||||| |||||||||||||||| |||| Sbjct: 43227 tccctgggatgggaagatcccctggagaaggaaatggcaacccactccagtattcttgcc 43168 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 |||||||| ||| |||||| || ||||| |||||||||||| | |||| |||||||| Sbjct: 43167 tagagaatcccatggacagaggggcctgctgggctacagtccatggggtcccaaagagtt 43108 Query: 467 gga 469 ||| Sbjct: 43107 gga 43105 Score = 107 bits (54), Expect = 6e-21 Identities = 120/142 (84%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 ||||||||||||||| |||| ||||||| |||| |||| ||||| |||||||| ||||| Sbjct: 23745 ggttcagtccctgggctgggatgatccccaggaggagggcatggcaacccactctagtat 23804 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || ||||| ||||| ||| ||||| |||||||||| ||||||||||| | |||| | | Sbjct: 23805 tcttgcctgaagaatcccatagacagaggagcctggcaggctacagtccatggggtcgca 23864 Query: 460 aagagttggatacaactgaagc 481 ||||||||| || ||||||||| Sbjct: 23865 aagagttggttataactgaagc 23886 Score = 93.7 bits (47), Expect = 1e-16 Identities = 116/139 (83%) Strand = Plus / Plus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||||||||||||| ||| ||| ||||| |||||| || |||||||||||| Sbjct: 43644 aaagaatctgcctgcaatgcaggagacctgggtttgatccctgtgttgggaagatcccct 43703 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||||| ||||||| |||||||| |||| ||| || ||| |||||| | Sbjct: 43704 ggagaaggccatggcaacccactgcagtattctcgcctggaggatcccatggacagagag 43763 Query: 430 gcctggcgggctacagtcc 448 ||||||||||||| ||||| Sbjct: 43764 gcctggcgggctatagtcc 43782 Score = 91.7 bits (46), Expect = 4e-16 Identities = 109/130 (83%) Strand = Plus / Plus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 ||||||| |||||| ||| ||| ||||| |||||| ||||||||||||||| |||||| Sbjct: 58875 tctgcctccaatgcaggagaccggggtttgatccctgagtggggaagatcccctggagaa 58934 Query: 376 gggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 || ||||| |||||||||| ||||| ||||| || |||||||||||| | | ||||||| Sbjct: 58935 ggaaatggtaacccactccaatattcttgcctggataataccacggactgagaagcctgg 58994 Query: 436 cgggctacag 445 |||||||| Sbjct: 58995 taggctacag 59004 Score = 89.7 bits (45), Expect = 2e-15 Identities = 78/89 (87%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || |||||||||||| |||| ||| |||||| |||||||||||||||| |||| Sbjct: 16120 tccctgtgttgggaagatcccctggaggaggaaatggcaacccactccagtattcttgcc 16179 Query: 407 tagagaataccacggacaggggagcctgg 435 | |||||| ||| |||||| ||||||||| Sbjct: 16180 tggagaatcccagggacagaggagcctgg 16208 Score = 87.7 bits (44), Expect = 6e-15 Identities = 80/92 (86%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||||| |||||||||||||||||| | ||||||||| | ||||| |||||| | Sbjct: 14038 gggaagatcccctggagaagggaatggctactcgctccagtatccttgcctggagaattc 13979 Query: 417 cacggacaggggagcctggcgggctacagtcc 448 || |||||| | | |||||| ||||||||||| Sbjct: 13978 catggacagagaaacctggcaggctacagtcc 13947 Score = 87.7 bits (44), Expect = 6e-15 Identities = 62/68 (91%) Strand = Plus / Plus Query: 381 tggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgggc 440 |||| |||||||||||||||| ||||| |||||| ||| |||||| |||||||||||||| Sbjct: 68650 tggcaacccactccagtattcttgcctggagaattccatggacagaggagcctggcgggc 68709 Query: 441 tacagtcc 448 |||||||| Sbjct: 68710 tacagtcc 68717 Score = 87.7 bits (44), Expect = 6e-15 Identities = 83/96 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| ||| ||| |||| |||| | ||||||| ||||||||| Sbjct: 63680 tggtaaagaatctgcctgcagtgcaggagaccctagttcgattcctgggtcgggaagatc 63739 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | |||||||||| |||||||||||||||||||| Sbjct: 63740 ctctggagaagggataggctacccactccagtattc 63775 Score = 77.8 bits (39), Expect = 6e-12 Identities = 84/99 (84%) Strand = Plus / Minus Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcggg 439 ||||| |||||||||||||||| |||||| | ||| ||| |||||| || ||||| ||| Sbjct: 2841 atggcaacccactccagtattcttgcctaaaaaatgccatggacagaggcacctggaggg 2782 Query: 440 ctacagtccctagggttgaaaagagttggatacaactga 478 ||||||||| ||||||| ||||||||||| ||||||| Sbjct: 2781 ctacagtccaaagggttgcaaagagttggacgcaactga 2743 Score = 75.8 bits (38), Expect = 2e-11 Identities = 74/86 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||||| ||||||||||||| | ||||| || | Sbjct: 65531 tccctgggtttggaagatcccctggagaagggactggctacccactctactattcttggc 65472 Query: 407 tagagaataccacggacaggggagcc 432 | |||||| ||| |||||| |||||| Sbjct: 65471 tggagaattccatggacagaggagcc 65446 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 26107 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 26048 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 26047 gcctggtgggct 26036 Score = 67.9 bits (34), Expect = 6e-09 Identities = 61/70 (87%) Strand = Plus / Plus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||||| Sbjct: 98904 agaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacgggggagc 98963 Query: 432 ctggcgggct 441 |||| ||||| Sbjct: 98964 ctggtgggct 98973 Score = 67.9 bits (34), Expect = 6e-09 Identities = 97/118 (82%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||| ||| ||| ||| ||||||| ||||||| | || ||||| Sbjct: 63794 tggtaaagaatctgcctgcgatgtgggagacctgggttcaatccctggattggaaagatg 63853 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || ||||||||||| ||||||| ||||| ||||| |||| |||||| ||| |||| Sbjct: 63854 ccatggagaagggaaaggctacctgctccaatattctggcctggagaattccatggac 63911 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 64112 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 64053 Query: 430 gcctgg 435 |||||| Sbjct: 64052 gcctgg 64047 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||| | ||| ||||| |||||| ||| |||||||||| Sbjct: 47608 ggagaaggaaatggcaacccactccactgttcttgcctggagaatcccagggacagggga 47549 Query: 430 gcctgg 435 |||||| Sbjct: 47548 gcctgg 47543 Score = 65.9 bits (33), Expect = 2e-08 Identities = 90/109 (82%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||| |||||||||| ||| ||| || || ||||||||| ||||||||| Sbjct: 36387 tggtaaagaatctacctgcaatgcgggagacctggatttgatccctgggttgggaagatc 36446 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 | | |||||||||| | ||||||||||||| ||| |||| |||||| Sbjct: 36447 ctctggagaagggatcaggtacccactccagtcttctggcctggagaat 36495 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 89502 ggagaaggaaatggccacccactccagtgttcttgcctggagaatcccagggatggggga 89443 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 89442 gcctggtgggct 89431 Score = 58.0 bits (29), Expect = 5e-06 Identities = 83/101 (82%) Strand = Plus / Minus Query: 346 gtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgc 405 |||||| ||| |||||||||||| |||| | || | | | ||||||| ||||||| ||| Sbjct: 618 gtccctaggttgggaagatcccctggaggaaggcaggtcaacccactagagtattcttgc 559 Query: 406 ctagagaataccacggacaggggagcctggcgggctacagt 446 || |||||| ||| || ||| ||||||||| |||||||||| Sbjct: 558 ctggagaatcccatgggcagaggagcctggtgggctacagt 518 >gb|CM000179| Bos taurus chromosome 3-FRAG[91530000,91629999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 144/161 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| ||||||| |||||||||| ||||||| Sbjct: 26530 atggtaaagaatctgcctgcaatgcaggagacctgggttcaatccctgggtgaggaagat 26471 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||| |||||||| |||||||||||| ||| ||||| |||||| ||| ||||| Sbjct: 26470 cccctggagaaaggaatggcaacccactccagtgttcttgcctggagaatcccagggaca 26411 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 ||||||||||| |||||||||||| | |||||| ||||||| Sbjct: 26410 ggggagcctggtgggctacagtccatggggttgcaaagagt 26370 Score = 107 bits (54), Expect = 6e-21 Identities = 117/138 (84%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||||||||| ||| ||| |||||| | ||||| | ||||||||||| Sbjct: 67080 gtaaagaatctgcctgcaatgagggagacctgggttctattcctggcttgggaagatccc 67021 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||||||||||||| ||||||| ||||| |||| ||||| ||| |||||| | Sbjct: 67020 ctggagaagggaatggctactcactccaatattctggcctgaagaattccatggacagag 66961 Query: 428 gagcctggcgggctacag 445 ||||||||| ||| |||| Sbjct: 66960 gagcctggcaggccacag 66943 Score = 95.6 bits (48), Expect = 2e-17 Identities = 130/156 (83%), Gaps = 1/156 (0%) Strand = Plus / Minus Query: 311 aagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccg 370 ||||||||||||||||| | ||| | ||||||| ||||||||| |||||||||||| | Sbjct: 84726 aagaatctgcctgcaatacaggagaaccgggtttgatccctgggttgggaagatcccctg 84667 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaat-accacggacagggga 429 || |||| ||||| |||||||||||| ||| ||||| |||||| ||| |||||| || Sbjct: 84666 aaggagggcatggcaacccactccagtgttcttgcctggagaatccccatggacagaggg 84607 Query: 430 gcctggcgggctacagtccctagggttgaaaagagt 465 ||||||| ||||| ||||| | |||||| ||||||| Sbjct: 84606 gcctggcaggctatagtccatggggttgcaaagagt 84571 Score = 95.6 bits (48), Expect = 2e-17 Identities = 111/132 (84%) Strand = Plus / Minus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||||||||| |||||| || ||| |||||| |||||||||||||||| |||| | Sbjct: 65457 ctgggtggggaaaatcccctctaggaggaaatggcaacccactccagtattcttgccagg 65398 Query: 410 agaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||| ||| ||||||||||||||||||||||||||| ||| |||| ||||||| || Sbjct: 65397 gaaatcccatatacaggggagcctggcgggctacagtccatagcgttgcaaagagtcaga 65338 Query: 470 tacaactgaagc 481 |||||||||||| Sbjct: 65337 tacaactgaagc 65326 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 80824 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 80883 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 80884 gcctggtgggct 80895 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 38842 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 38783 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 38782 gcctggtgggct 38771 Score = 69.9 bits (35), Expect = 1e-09 Identities = 78/91 (85%), Gaps = 1/91 (1%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaaccc-gggttcagtccctgggtggggaagatc 365 |||||||||| | ||||||||| | | |||| |||||| ||||||||| || |||||| Sbjct: 50140 ggtaaagaatatatctgcaatgcagaagacccagggttccatccctgggttggaaagatc 50199 Query: 366 ccccggagaagggaatggctacccactccag 396 ||| |||||| |||||||||||||||||||| Sbjct: 50200 ccctggagaaaggaatggctacccactccag 50230 Score = 67.9 bits (34), Expect = 6e-09 Identities = 61/70 (87%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| | | |||||| ||||||||| |||||||||| Sbjct: 47168 gtaaagaatctgcctgcaatgcaggagaactgggttcgatccctgggtcaggaagatccc 47227 Query: 368 ccggagaagg 377 | |||||||| Sbjct: 47228 ctggagaagg 47237 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||| | |||||| |||||||||||| ||| | ||| |||||| ||| |||||||||| Sbjct: 8392 ggagaaagaaatggcaacccactccagtgttcttacctggagaatcccagggacagggga 8333 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 8332 gcctggtgggct 8321 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||| |||||||||||| ||||| |||||| ||| |||| ||||| Sbjct: 62247 ggagaaggaaatggcaaccaactccagtattcttgcctggagaatcccagggacggggga 62188 Query: 430 gcctggcgggct 441 || ||| ||||| Sbjct: 62187 gcatggtgggct 62176 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 34129 ggagaaggcaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 34070 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 34069 gcctggtgggct 34058 Score = 58.0 bits (29), Expect = 5e-06 Identities = 41/45 (91%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattc 401 |||||||||||| |||| ||| |||||| |||||||||||||||| Sbjct: 97616 gggaagatcccctggagtaggaaatggcaacccactccagtattc 97572 >gb|CM000178| Bos taurus chromosome 2-FRAG[68310000,68409999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 147/165 (89%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| || ||||||||||||||||| |||||||| Sbjct: 20550 atggtaaagaatctgcctgcaatgcaggagacttgggttcagtccctgggttgggaagat 20609 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||| ||||||||| ||| ||||| |||||| ||| ||||| Sbjct: 20610 cccctggagaagggaatggctactcactccagtgttcttgcctggagaatcccatggaca 20669 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | ||||||||| |||||||||||| |||||| | |||||| |||| Sbjct: 20670 gaggagcctggtgggctacagtccatagggtcgcaaagagctgga 20714 Score = 93.7 bits (47), Expect = 1e-16 Identities = 159/195 (81%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||| ||||||||||||||||| ||| | ||| |||||||| ||||||| Sbjct: 86438 atggtaaagaaactgcctgcaatgctggagacctgagtttgacccctgggtcaggaagat 86497 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||||||||||||| |||||| |||||||||| ||| | |||||| | | |||| Sbjct: 86498 gccctggagaagggaatggttacccattccagtattcttgcttggagaattcaatagaca 86557 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | |||||||| |||||||| ||| | | || | |||||||| || |||||| |||| | Sbjct: 86558 gaagagcctggagggctacaatccatggtgtagcaaagagttagacacaact-aagcagc 86616 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 86617 taacactttcacttt 86631 Score = 87.7 bits (44), Expect = 6e-15 Identities = 98/116 (84%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||||||||| | ||||||||||||| ||||| |||||| | | |||||| ||| Sbjct: 60558 ggagaagggaatggtaatccactccagtattgttgcctggagaatcctatggacagagga 60617 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 | |||||||||| |||||| ||| |||| ||| ||||||| |||||||||| |||| Sbjct: 60618 gactggcgggctgcagtccatagagttgcaaaaagttggacacaactgaagtgact 60673 Score = 87.7 bits (44), Expect = 6e-15 Identities = 101/120 (84%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||||||| |||||| |||||||||||||||| ||||| || | | ||| Sbjct: 9636 gaagatcccctggagaaggaaatggcaacccactccagtattcttgcctggaaagtccca 9577 Query: 419 cggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | ||| |||||||||| ||||||||||| | |||| ||||||||||| |||||||| Sbjct: 9576 tgcacaaaggagcctggcaggctacagtccatggggtcacaaagagttggacacaactga 9517 Score = 81.8 bits (41), Expect = 4e-13 Identities = 86/101 (85%) Strand = Plus / Minus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| || ||||||||| |||| |||| |||| |||||||||||| ||| ||||| Sbjct: 7187 ccctgggttggaaagatcccctggaggagggcatggaaacccactccagttttcttgcct 7128 Query: 408 agagaataccacggacaggggagcctggcgggctacagtcc 448 |||||| |||||||||| |||||| || ||| |||||||| Sbjct: 7127 ggagaatcccacggacagaggagccaggtggggtacagtcc 7087 Score = 81.8 bits (41), Expect = 4e-13 Identities = 81/93 (87%), Gaps = 1/93 (1%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||| ||||||| |||||| ||| ||| |||||||||||||| || ||||||||| Sbjct: 44690 ggtaaagtgtctgcctacaatgcgggagacctgggttcagtccctgagtcgggaagatct 44749 Query: 367 cccggagaagggaatggctacccactccagtat 399 || |||||| |||||||| |||||||||||||| Sbjct: 44750 cctggagaa-ggaatggcaacccactccagtat 44781 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 11428 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 11487 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 11488 gcctggtgggct 11499 Score = 73.8 bits (37), Expect = 9e-11 Identities = 76/89 (85%) Strand = Plus / Minus Query: 390 actccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtccc 449 |||||||||||| ||||| |||||| ||| |||||| ||||| |||||||||||||||| Sbjct: 94120 actccagtattcttgcctggagaatcccatggacagaggagcttggcgggctacagtcca 94061 Query: 450 tagggttgaaaagagttggatacaactga 478 | |||| | ||||||| || |||||||| Sbjct: 94060 tggggtcgcaaagagtcagacacaactga 94032 Score = 71.9 bits (36), Expect = 4e-10 Identities = 96/116 (82%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 89902 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 89961 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||| | | ||||| |||||| |||||||||||| Sbjct: 89962 gcctggtgggctgccgtctatggggtcgcacagagtcggatacgactgaagcgact 90017 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| ||| ||||| Sbjct: 38632 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggatggggga 38573 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 38572 gcctggtgggct 38561 Score = 71.9 bits (36), Expect = 4e-10 Identities = 117/144 (81%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| |||||||||| || ||| ||||||||| |||||||| |||||| | Sbjct: 36736 atggtaaagcgtctgcctgcagtgtgggagacccgggtttgacccctgggttgggaaggt 36795 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| ||| |||| |||||| ||||||||||||| || ||||| || ||| ||| |||| Sbjct: 36796 accctggaaaaggaaatggcaacccactccagtactcttgcctggaaaattccatggact 36855 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||||| ||||||||||| Sbjct: 36856 gaggagcctggtaggctacagtcc 36879 Score = 69.9 bits (35), Expect = 1e-09 Identities = 74/87 (85%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||||||||||||| |||||||||||| |||| | | ||||| | |||||||| || Sbjct: 55346 gggttcagtccctgggttgggaagatcccctggaggaaagcatggcaaaccactccatta 55287 Query: 399 ttcatgcctagagaataccacggacag 425 ||| ||||| |||||| ||| |||||| Sbjct: 55286 ttcttgcctggagaatcccatggacag 55260 Score = 67.9 bits (34), Expect = 6e-09 Identities = 52/58 (89%) Strand = Plus / Plus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctac 443 |||||||||||||||| ||||| |||||| ||| ||| || ||||||||||||||||| Sbjct: 74554 acccactccagtattcttgcctggagaatcccatggatagaggagcctggcgggctac 74611 Score = 65.9 bits (33), Expect = 2e-08 Identities = 60/69 (86%) Strand = Plus / Minus Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcggg 439 ||||| |||||||||||||||| ||| |||||| |||||||||| |||||| ||| || Sbjct: 40544 atggcaacccactccagtattctcacctggagaatcccacggacagaggagccaggcagg 40485 Query: 440 ctacagtcc 448 ||||||||| Sbjct: 40484 ctacagtcc 40476 Score = 63.9 bits (32), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 |||||||||||||||| ||| | |||||| ||| |||||| |||||||||| ||| |||| Sbjct: 5542 acccactccagtattcttgcttggagaatcccatggacagaggagcctggcaggccacag 5483 Query: 446 tccctagggttgaaaagagt 465 ||| | |||| | ||||||| Sbjct: 5482 tccatggggtcgcaaagagt 5463 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| || ||| ||| |||| ||||| Sbjct: 3461 ggagaaggaaatggcaacccactccagtgttcttgcctggataatcccagggacggggga 3402 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 3401 gcctggtgggct 3390 Score = 63.9 bits (32), Expect = 9e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 381 tggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgggc 440 |||| |||||||||||||||| || || |||||| ||| |||||| ||||||| | |||| Sbjct: 75385 tggcaacccactccagtattcttgtctggagaatcccatggacagaggagccttgtgggc 75326 Query: 441 tacagtcc 448 |||||||| Sbjct: 75325 tacagtcc 75318 Score = 61.9 bits (31), Expect = 3e-07 Identities = 73/87 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| ||| ||||||||||| |||| ||| |||||| ||||| |||||||||| |||| Sbjct: 16681 tccctgagtgtggaagatcccctggaggaggaaatggcaacccattccagtattcttgcc 16740 Query: 407 tagagaataccacggacaggggagcct 433 | | ||| ||| |||||| ||||||| Sbjct: 16741 tgggtaatcccatggacagaggagcct 16767 Score = 61.9 bits (31), Expect = 3e-07 Identities = 91/111 (81%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| || | || |||||| ||||||||||| |||| |||| Sbjct: 89057 tccctgggtcaggaagatcccctggggtagaaaatggcaacccactccaggattcttgcc 89116 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 | | ||| ||| |||||||| ||| ||| |||||||||||| ||||||| Sbjct: 89117 tgggaaattccatggacagggcagcttggtgggctacagtccacagggttg 89167 Score = 60.0 bits (30), Expect = 1e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| | |||||||||| |||| ||| | |||| ||||||||||||| || ||||| Sbjct: 90320 ccctgggtcgagaagatcccctggaggaggaactggcaacccactccagtaatcttgcct 90261 Query: 408 agagaataccacggacag 425 |||||| ||| |||||| Sbjct: 90260 ggagaattccatggacag 90243 >gb|CM000205| Bos taurus chromosome 29-FRAG[25830000,25929999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 147/165 (89%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||| |||||||||| ||| |||||||||| ||||||||| ||| |||| Sbjct: 8237 atggtaaagaatctacctgcaatgcaggagacccgggttcgatccctgggttgggcagat 8296 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 8297 cccctggagaagggaatggctacccactccagtattcttgcctggagaatcccatggaca 8356 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||||| ||||||| |||||| | |||| | ||||||||||| Sbjct: 8357 ggggagcctagcgggctgcagtccatggggtcgcaaagagttgga 8401 Score = 123 bits (62), Expect = 1e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||| |||||| ||| | ||||||| |||||||||| Sbjct: 56411 ggtaaagaatctgcctgcaatgcaggagacccggattcgattcctgggtcgggaagatcc 56352 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||||||| |||||| |||||||||||||||| || || || ||| |||| || || Sbjct: 56351 cctggagaaggaaatggcaacccactccagtattcttgactggaaaatcccacagataga 56292 Query: 427 ggagcctggcgggctacagtcc 448 ||||||||| |||||| ||||| Sbjct: 56291 ggagcctggtgggctatagtcc 56270 Score = 117 bits (59), Expect = 7e-24 Identities = 89/99 (89%) Strand = Plus / Plus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| |||||||||||| |||||||| |||||| |||||||||||||||| ||||| | Sbjct: 35273 ctgggttgggaagatcccctggagaaggaaatggcaacccactccagtattcttgcctgg 35332 Query: 410 agaataccacggacaggggagcctggcgggctacagtcc 448 ||||| ||| |||||| ||||||||| |||||||||||| Sbjct: 35333 agaattccatggacagaggagcctggtgggctacagtcc 35371 Score = 111 bits (56), Expect = 4e-22 Identities = 122/144 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||| ||| |||| | || ||||||||| |||||||| Sbjct: 79590 atggtaaagaatctgcctgcaatatgggagacccagatttgatccctgggttgggaagat 79649 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| || ||||||| |||||||||||| ||||| || ||| ||| |||| Sbjct: 79650 cccctggagaaggaaaaggctacctactccagtattcttgcctggaaaatcccatggacc 79709 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||||| |||||||||||| Sbjct: 79710 gaggagcctggtgggctacagtcc 79733 Score = 111 bits (56), Expect = 4e-22 Identities = 86/96 (89%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| ||| | ||||| ||||||||| ||||||| Sbjct: 16412 tggtaaagaatctgcctgcaatgcgggagacctgagttcaatccctgggttgggaagagt 16471 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||||| |||||||||||||||||||| Sbjct: 16472 ccctggagaagggaaaggctacccactccagtattc 16507 Score = 107 bits (54), Expect = 6e-21 Identities = 96/110 (87%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||| ||||||| |||||||||| ||| ||| || |||||||||||||| ||||| ||| Sbjct: 82892 tggttaagaatcctcctgcaatgcaggagacctggattcagtccctgggttgggaacatc 82951 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaata 415 ||| ||||||||||| |||||||||||||||||||| |||| ||||||| Sbjct: 82952 ccctggagaagggaaaggctacccactccagtattctggcctggagaata 83001 Score = 99.6 bits (50), Expect = 2e-18 Identities = 95/110 (86%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| |||||| || | ||||||| || |||||| || |||||||||||||||||| Sbjct: 30098 gggttcaatccctgagttgagaagatcacctggagaacagagtggctacccactccagta 30157 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| ||||| |||||| ||| |||||| ||||||||| |||||||||||| Sbjct: 30158 ttcttgcctggagaattccatggacagaggagcctggtgggctacagtcc 30207 Score = 93.7 bits (47), Expect = 1e-16 Identities = 119/143 (83%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| |||| ||| ||| ||| | | | ||||||| || ||||| Sbjct: 76352 atggtaaagaatctgcctgtaatgtgggagacctgggctaaattcctgggtcggaaagat 76411 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| || |||||||||||| ||||||| ||||| |||| | || ||||| Sbjct: 76412 cccctggagaaggaaaaggctacccactctagtattcttgcctggagactctcagggaca 76471 Query: 425 ggggagcctggcgggctacagtc 447 | |||||||| ||||||||||| Sbjct: 76472 gaagagcctggagggctacagtc 76494 Score = 91.7 bits (46), Expect = 4e-16 Identities = 73/82 (89%) Strand = Plus / Minus Query: 363 atcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgga 422 |||||| ||||||||||||||| |||||||||||||||| ||||| |||||| ||| ||| Sbjct: 80220 atcccctggagaagggaatggcaacccactccagtattcttgcctggagaattccatgga 80161 Query: 423 caggggagcctggcgggctaca 444 ||| ||||||||| || ||||| Sbjct: 80160 cagaggagcctggtggactaca 80139 Score = 87.7 bits (44), Expect = 6e-15 Identities = 80/92 (86%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||| ||| ||||||| |||| || |||||||||||||||| ||||| |||||| | Sbjct: 74646 gggaagattccctggagaagagaatagcaacccactccagtattcttgcctggagaatcc 74705 Query: 417 cacggacaggggagcctggcgggctacagtcc 448 || |||||| ||||||||| ||| |||||||| Sbjct: 74706 catggacagaggagcctggtgggttacagtcc 74737 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 84503 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacagcgga 84562 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 84563 gcctggtgggct 84574 Score = 75.8 bits (38), Expect = 2e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 |||||||||| |||||| |||||| |||| ||| |||| ||||| ||||||||||||| Sbjct: 10632 gggttcagtctctgggttaggaagaacccctagaggagggcatggcaacccactccagta 10691 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| ||||| || || |||||||||| ||||||||| | | |||||||| Sbjct: 10692 ttcttgcctggaaaagcccacggacagaggagcctggagagttacagtcc 10741 Score = 75.8 bits (38), Expect = 2e-11 Identities = 108/130 (83%), Gaps = 1/130 (0%) Strand = Plus / Plus Query: 319 gcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggg 378 ||||||||||| ||| |||| |||| | ||||||||| |||| |||||| |||||||| Sbjct: 22080 gcctgcaatgcaggagacccaggtttaatccctgggtcaggaaaatcccctggagaagga 22139 Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| ||||| || ||||||| ||| | ||||| ||| |||||| ||||| ||| || Sbjct: 22140 aatggcaacccattctagtattcttgcttgaagaat-ccatggacagaggagcttggtgg 22198 Query: 439 gctacagtcc 448 |||||||||| Sbjct: 22199 gctacagtcc 22208 Score = 73.8 bits (37), Expect = 9e-11 Identities = 119/145 (82%), Gaps = 1/145 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| ||||||||| | ||| ||||||||| ||||||||| ||||| Sbjct: 20839 atggtaaagaatgtgcctgcaaggtgggagacccgggtttgatccctgggtcaagaagac 20898 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| || |||||||||||| ||||||||| |||||| || || |||||| ||| |||| Sbjct: 20899 accctggtgaagggaatggccacccactcctgtattcttgactggagaattccatggact 20958 Query: 425 ggggagcctggcg-ggctacagtcc 448 | ||||||||| | ||||||||||| Sbjct: 20959 gaggagcctggtgtggctacagtcc 20983 Score = 73.8 bits (37), Expect = 9e-11 Identities = 82/97 (84%) Strand = Plus / Minus Query: 351 tgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctaga 410 ||||| |||||||||||| ||||||||||| |||||||| ||||||||| ||||| || Sbjct: 16076 tgggttgggaagatcccctggagaagggaacggctacccctaccagtattcttgcctgga 16017 Query: 411 gaataccacggacaggggagcctggcgggctacagtc 447 |||| | |||||| ||||||||| |||||||||| Sbjct: 16016 gaatctcgtggacagaagagcctggctggctacagtc 15980 Score = 73.8 bits (37), Expect = 9e-11 Identities = 101/121 (83%), Gaps = 1/121 (0%) Strand = Plus / Plus Query: 349 cctgggtggggaagatccccc-ggagaagggaatggctacccactccagtattcatgcct 407 ||||||| ||||||||||||| |||| ||| |||||| |||||||||| ||||| ||||| Sbjct: 52256 cctgggtagggaagatccccctggaggaggaaatggcaacccactccaatattcttgcct 52315 Query: 408 agagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttg 467 || ||| ||| | |||| ||| ||||| ||||||||||| | |||||| ||||| ||| Sbjct: 52316 ggacaatcccatgaacagaggaacctggtgggctacagtctatggggttgcaaagacttg 52375 Query: 468 g 468 | Sbjct: 52376 g 52376 Score = 69.9 bits (35), Expect = 1e-09 Identities = 106/127 (83%), Gaps = 2/127 (1%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| |||| ||| |||||||||||| |||||||| |||||| |||||| |||| | Sbjct: 69639 ggttcaatccccaggttgggaagatcccctggagaaggaaatggcaacccacatcagtgt 69580 Query: 400 tcatgcct-agagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 || ||||| ||| ||| ||| |||||| |||||||| |||||||||||| | |||||| Sbjct: 69579 tcttgcctgaga-aatcccatggacagaggagcctgatgggctacagtccatggggttgc 69521 Query: 459 aaagagt 465 ||||||| Sbjct: 69520 aaagagt 69514 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/86 (84%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||| ||| |||||||| | || | |||||||||||||||| ||||| |||||| ||| Sbjct: 32722 gaagattccctggagaaggaagtgacaacccactccagtattcttgcctggagaatccca 32663 Query: 419 cggacaggggagcctggcgggctaca 444 |||||| |||||| | ||||||||| Sbjct: 32662 tggacagaggagcccgacgggctaca 32637 Score = 65.9 bits (33), Expect = 2e-08 Identities = 66/77 (85%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 ||||||||||||||| |||| ||| | | |||||||||||||| ||||| |||||| ||| Sbjct: 33494 gaagatcccccggaggagggcatgacaatccactccagtattcttgcctggagaatccca 33435 Query: 419 cggacaggggagcctgg 435 | ||||| |||| |||| Sbjct: 33434 cagacagaggaggctgg 33418 Score = 63.9 bits (32), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Plus Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||| |||||| ||||||||||||| || ||||| || ||| ||| |||||| || Sbjct: 82208 cggagaaggcaatggcaacccactccagtactcttgcctggaaaatcccatggacagagg 82267 Query: 429 agcctggcgggctacagtcc 448 ||||||| |||| |||||| Sbjct: 82268 agcctggtaggctgcagtcc 82287 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||| || Sbjct: 85968 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagcaga 86027 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 86028 gcctggtgggct 86039 Score = 60.0 bits (30), Expect = 1e-06 Identities = 75/90 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| ||||| ||||||||| |||||||| Sbjct: 28937 tggtaaagaatccacctgcaatgtgggagacctgggtttgatccctgggtttggaagatc 28996 Query: 366 ccccggagaagggaatggctacccactcca 395 | |||||||||||||||||| ||||||| Sbjct: 28997 ttctggagaagggaatggctactcactcca 29026 Score = 60.0 bits (30), Expect = 1e-06 Identities = 78/94 (82%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| || |||| ||| ||| |||||||| ||||| ||||| Sbjct: 2895 cctgggtcaggaagatcccctggtgaagagaaaggcagcccactcccatattcttgcctg 2836 Query: 409 gagaataccacggacaggggagcctggcgggcta 442 |||||| ||| |||||| ||||||||| |||||| Sbjct: 2835 gagaattccatggacagaggagcctggtgggcta 2802 Score = 60.0 bits (30), Expect = 1e-06 Identities = 66/78 (84%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| || ||| ||| ||| | ||| Sbjct: 68228 ggagaaggaaatggcaacccactccagtattcttgcctggaaaatcccatggatggagga 68169 Query: 430 gcctggcgggctacagtc 447 |||||| |||||||||| Sbjct: 68168 tcctggcaggctacagtc 68151 Score = 58.0 bits (29), Expect = 5e-06 Identities = 53/61 (86%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| | ||||||| ||||||||| || || ||||| |||||| ||||||||||||| Sbjct: 68294 gggttcaattcctgggtcgggaagatctcctggtgaaggaaatggcaacccactccagta 68235 Query: 399 t 399 | Sbjct: 68234 t 68234 >gb|CM000205| Bos taurus chromosome 29-FRAG[25740000,25839999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 147/165 (89%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||| |||||||||| ||| |||||||||| ||||||||| ||| |||| Sbjct: 98237 atggtaaagaatctacctgcaatgcaggagacccgggttcgatccctgggttgggcagat 98296 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 98297 cccctggagaagggaatggctacccactccagtattcttgcctggagaatcccatggaca 98356 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||||| ||||||| |||||| | |||| | ||||||||||| Sbjct: 98357 ggggagcctagcgggctgcagtccatggggtcgcaaagagttgga 98401 Score = 157 bits (79), Expect = 8e-36 Identities = 127/143 (88%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| |||| |||||| ||||||||| |||||| | Sbjct: 22820 atggtaaagaatctgcctgcagtgcaggagacccaggttcaatccctgggtagggaaggt 22879 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||||||||| |||||||||| ||||| |||||| ||| ||| | Sbjct: 22880 cccctggagaagggaatggctacccattccagtattcttgcctggagaatcccatggata 22939 Query: 425 ggggagcctggcgggctacagtc 447 | ||||||||| ||||||||||| Sbjct: 22940 gaggagcctggtgggctacagtc 22962 Score = 117 bits (59), Expect = 7e-24 Identities = 122/143 (85%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||| |||||||||| ||| ||| ||||| |||||||||| || ||||| Sbjct: 21936 atggtaaagaatccacctgcaatgcaggagacctgggtttggtccctgggttggcaagat 21877 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||| |||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 21876 cccctcgagaaggcaatggcaacccactccagtattcttgcctggagaatcccatggaca 21817 Query: 425 ggggagcctggcgggctacagtc 447 | |||||||| |||||||||| Sbjct: 21816 gaggagcctgataggctacagtc 21794 Score = 99.6 bits (50), Expect = 2e-18 Identities = 128/154 (83%) Strand = Plus / Minus Query: 312 agaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccgg 371 |||| ||||||||||||| ||| ||| |||||| ||||||||| |||||||||| | || Sbjct: 30854 agaaactgcctgcaatgcaggagacctgggttcgatccctgggttgggaagatcctctgg 30795 Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||| |||||||||| ||||||||||||| ||||| |||||| || |||| ||||| Sbjct: 30794 agaaaggaatggctattcactccagtattcttgcctggagaatttcatagacacaggagc 30735 Query: 432 ctggcgggctacagtccctagggttgaaaagagt 465 |||| |||||| | ||| | |||||| ||||||| Sbjct: 30734 ctggtgggctataatccatggggttgcaaagagt 30701 Score = 97.6 bits (49), Expect = 6e-18 Identities = 137/165 (83%), Gaps = 1/165 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||| ||| ||||| ||||||| ||||||| |||||||| |||||||| Sbjct: 24613 tggtaaagaatctgcttgccaatgcaggaaacctgggttcaacccctgggttgggaagat 24672 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||| ||| ||| | |||| || ||| |||| | || |||||| ||| ||||| Sbjct: 24673 cccctggaggaggaaatagtaacccgctacagaattcttatctggagaatcccatggaca 24732 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | ||||||||| |||||||||||| | |||||| |||||| |||| Sbjct: 24733 gaggagcctggtgggctacagtccatggggttgcaaagagctgga 24777 Score = 97.6 bits (49), Expect = 6e-18 Identities = 100/117 (85%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||| || |||||||| |||||||||||||||||| |||| |||||| Sbjct: 46675 cctgggtcaggaagatctcctggagaaggaaatggctacccactccagcattcttgccta 46616 Query: 409 gagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 || ||| ||| |||||| ||||||||| |||||| ||| | | |||||| ||||||| Sbjct: 46615 gaaaattccatggacagaggagcctggtgggctatagttcgtggggttgtaaagagt 46559 Score = 93.7 bits (47), Expect = 1e-16 Identities = 86/99 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||||| ||||||||| |||||||| |||||| ||||||| |||||||| |||| Sbjct: 7731 tccctgggtggagaagatcccttggagaaggaaatggcaacccacttcagtattcttgcc 7790 Query: 407 tagagaataccacggacaggggagcctggcgggctacag 445 | || ||||||| |||||| |||||| || ||||||||| Sbjct: 7791 tggaaaataccatggacagaggagccaggtgggctacag 7829 Score = 93.7 bits (47), Expect = 1e-16 Identities = 123/148 (83%), Gaps = 4/148 (2%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||| |||||| ||||||||| ||||||| Sbjct: 58619 atggtaaagaatctgcctgcaatgcaggagacccaggttcaatccctgggtctggaagat 58678 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaatac----cacg 420 || | || ||||||||||| || || |||||||||| || || ||| || | || | Sbjct: 58679 ccactggtaaagggaatggcaactcattccagtattcttgtctggagtattcttgtcatg 58738 Query: 421 gacaggggagcctggcgggctacagtcc 448 ||||| |||||||||| ||||||||||| Sbjct: 58739 gacagaggagcctggcaggctacagtcc 58766 Score = 91.7 bits (46), Expect = 4e-16 Identities = 106/126 (84%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||||||||||||| |||||||||||| |||| |||| ||||| | || |||| || Sbjct: 88392 ggttcagtccctgggttgggaagatcccctggaggagggtatggcaatgcatgccagcat 88451 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || | ||| |||||| ||| |||||| |||||||| |||||||||||| |||||||| | Sbjct: 88452 tcttccctggagaatcccatggacagaggagcctgatgggctacagtccatagggttgca 88511 Query: 460 aagagt 465 |||||| Sbjct: 88512 aagagt 88517 Score = 87.7 bits (44), Expect = 6e-15 Identities = 83/96 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| || ||| ||| |||| | ||| Sbjct: 31134 ggagaaggaaatggcaacccactccagtattcttgcctggaaaatcccatggacggagga 31193 Query: 430 gcctggcgggctacagtccctagggttgaaaagagt 465 ||||||| ||||||||||| | |||||| ||||||| Sbjct: 31194 gcctggcaggctacagtccatggggttgcaaagagt 31229 Score = 87.7 bits (44), Expect = 6e-15 Identities = 86/100 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||| ||||||| |||||||| || | | |||||||||||||||| |||| Sbjct: 65484 tccctgggttgggaggatcccctggagaaggaaaggacaacccactccagtattcttgcc 65425 Query: 407 tagagaataccacggacaggggagcctggcgggctacagt 446 | | ||| ||| |||||| |||||||||||||||||||| Sbjct: 65424 tgggaaatcccatggacagaggagcctggcgggctacagt 65385 Score = 85.7 bits (43), Expect = 2e-14 Identities = 124/151 (82%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||| |||||||| ||| ||| ||||| ||||||||| ||||| || Sbjct: 26417 atggtaaagactctgtctgcaatgtaggagacctgggtttgatccctgggttgggaaaat 26476 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| | | ||||| ||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 26477 cccttgaacaagggcatggcaacccactccagtattcttgcctggagaatcccaaggaca 26536 Query: 425 ggggagcctggcgggctacagtccctagggt 455 | ||||||| ||||||||||| |||||| Sbjct: 26537 gaggagccttataggctacagtccatagggt 26567 Score = 85.7 bits (43), Expect = 2e-14 Identities = 85/99 (85%) Strand = Plus / Plus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||||||||| || |||||||||||||||| ||| ||| || ||| |||||||||||| Sbjct: 55230 cgggttcagtctctaggtggggaagatcccctagaggaggaaaaggcaacccactccagt 55289 Query: 398 attcatgcctagagaataccacggacaggggagcctggc 436 |||| ||||| |||||| ||| || ||| |||||||||| Sbjct: 55290 attcttgcctggagaatcccatgggcagaggagcctggc 55328 Score = 83.8 bits (42), Expect = 9e-14 Identities = 54/58 (93%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccag 396 ||||||| ||||||||| |||||||||||| |||||||| |||||||||||||||||| Sbjct: 14240 gggttcaatccctgggttgggaagatcccctggagaaggaaatggctacccactccag 14183 Score = 75.8 bits (38), Expect = 2e-11 Identities = 89/106 (83%) Strand = Plus / Minus Query: 360 aagatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccac 419 ||||||||| ||||| | |||||| ||||||| |||||||| ||||| | ||| ||| Sbjct: 87545 aagatcccctagagaaagaaatggcaacccactgcagtattcttgcctgggaaattccat 87486 Query: 420 ggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 |||||| ||||||||||||| |||||||| | |||||| ||||||| Sbjct: 87485 ggacagaggagcctggcgggatacagtccatggggttgcaaagagt 87440 Score = 71.9 bits (36), Expect = 4e-10 Identities = 96/116 (82%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| | |||| ||| ||||| ||| Sbjct: 26162 ggagaaggaaatggcaacccactccagtgttcttgcctggggaatcccagggacaagggg 26221 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | |||| | |||||| | ||||||||| | |||||||||||| Sbjct: 26222 gcctggtgggctgccgtccatggggttgcacagagttggacatgactgaagcgact 26277 Score = 69.9 bits (35), Expect = 1e-09 Identities = 86/103 (83%) Strand = Plus / Plus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| |||||||||||||| | ||||| |||||| ||| |||||| || |||||| | Sbjct: 6765 aatggcaacccactccagtatccttgcctggagaatcccatggacagaagaacctggcag 6824 Query: 439 gctacagtccctagggttgaaaagagttggatacaactgaagc 481 |||||||||| ||||| | |||||| |||| || |||||||| Sbjct: 6825 gctacagtccataggggagcaaagagctggacacgactgaagc 6867 Score = 65.9 bits (33), Expect = 2e-08 Identities = 72/85 (84%) Strand = Plus / Minus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| ||||||||| |||||| ||| |||||||||||||| |||||||||||| || Sbjct: 66184 gttcaatccctgggtcaagaagataccctggagaagggaatggaaacccactccagtttt 66125 Query: 401 catgcctagagaataccacggacag 425 | ||||| |||||| ||| |||||| Sbjct: 66124 cttgcctggagaattccatggacag 66100 Score = 65.9 bits (33), Expect = 2e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 4218 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 4159 Query: 430 gcctg 434 ||||| Sbjct: 4158 gcctg 4154 Score = 63.9 bits (32), Expect = 9e-08 Identities = 85/102 (83%), Gaps = 3/102 (2%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | ||||| |||||| ||||| || |||||| |||||||||||||||| |||| Sbjct: 12819 tccctggattgggaaaatcccctggagagggaaatggcaacccactccagtattcttgcc 12760 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| ||||||| ||||||| ||||||||||| Sbjct: 12759 tgggaaatcccatggacagg---gcctggcaggctacagtcc 12721 Score = 63.9 bits (32), Expect = 9e-08 Identities = 50/56 (89%) Strand = Plus / Plus Query: 352 gggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||| |||||||||| | |||||||| |||||| |||||||||||||||| ||||| Sbjct: 31066 gggtcgggaagatcctctggagaaggaaatggcaacccactccagtattcttgcct 31121 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| || |||| ||||| Sbjct: 87802 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatctcagggacggggga 87861 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 87862 gcctggtgggct 87873 Score = 63.9 bits (32), Expect = 9e-08 Identities = 50/56 (89%) Strand = Plus / Plus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggct 441 |||||||||||| ||| ||||| |||||| ||| |||||||||||||||| ||||| Sbjct: 63228 acccactccagtgttcttgcctggagaatcccagggacaggggagcctggtgggct 63283 Score = 61.9 bits (31), Expect = 3e-07 Identities = 91/111 (81%) Strand = Plus / Plus Query: 375 agggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctg 434 |||||||||| | ||||||||||| | ||||| |||||| ||| |||||| ||| |||| Sbjct: 56429 agggaatggcaatccactccagtacacttgcctggagaatcccatggacagaggaccctg 56488 Query: 435 gcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 | |||||||||||| ||| || ||||||| ||| | ||||||| ||||| Sbjct: 56489 gtgggctacagtccatagagtcacaaagagtcggacataactgaatcgact 56539 Score = 60.0 bits (30), Expect = 1e-06 Identities = 112/138 (81%), Gaps = 1/138 (0%) Strand = Plus / Minus Query: 312 agaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc-g 370 |||||||||||||||||| ||| ||| | ||| ||| ||||| ||||||| |||| | Sbjct: 35267 agaatctgcctgcaatgcaggagacctgagtttgatccgtgggtcaggaagattcccctg 35208 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| ||| | |||||||||||||||| ||||| || ||| || ||||| ||| Sbjct: 35207 gagaaggacatgtcaacccactccagtattcttgcctggaaaatgccttggacaaaggaa 35148 Query: 431 cctggcgggctacagtcc 448 |||||| ||||||||||| Sbjct: 35147 cctggcaggctacagtcc 35130 Score = 60.0 bits (30), Expect = 1e-06 Identities = 78/94 (82%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| || |||| ||| ||| |||||||| ||||| ||||| Sbjct: 92895 cctgggtcaggaagatcccctggtgaagagaaaggcagcccactcccatattcttgcctg 92836 Query: 409 gagaataccacggacaggggagcctggcgggcta 442 |||||| ||| |||||| ||||||||| |||||| Sbjct: 92835 gagaattccatggacagaggagcctggtgggcta 92802 Score = 60.0 bits (30), Expect = 1e-06 Identities = 60/70 (85%) Strand = Plus / Plus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||||||||||| |||||||| ||||| || ||| || |||||| |||| |||| || Sbjct: 62306 aatggctacccacttcagtattcttgcctggacaattacagggacagaggagtctggtgg 62365 Query: 439 gctacagtcc 448 |||||||||| Sbjct: 62366 gctacagtcc 62375 Score = 58.0 bits (29), Expect = 5e-06 Identities = 54/61 (88%), Gaps = 1/61 (1%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| | |||||| |||||| |||||||||||||||| |||| Sbjct: 27927 tccctgggtcgggaagatccct-gaagaaggaaatggcaacccactccagtattcttgcc 27869 Query: 407 t 407 | Sbjct: 27868 t 27868 >gb|CM000201| Bos taurus chromosome 25-FRAG[9000000,9099999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 144/161 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||||||||| ||||||||| |||||||| Sbjct: 1837 atggtaaagaatctgcctgcaatgcaggagacccgggttcgatccctgggttgggaagat 1778 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| |||| |||||| ||| ||||| Sbjct: 1777 cccctggagaagggaatggctacccactccagtattctggcctggagaatgccatggaca 1718 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||||||| ||||||||||| | |||| | ||||||| Sbjct: 1717 gaggagcctggcaggctacagtccatggggtcgcaaagagt 1677 Score = 165 bits (83), Expect = 3e-38 Identities = 128/143 (89%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| ||| ||||||||| ||| ||| ||||||||| Sbjct: 22464 tggtaaagaatctgcctgcaatgcaggagacctgggttcagttcctcggttgggaagatc 22523 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||||| |||||||||||||| ||||| ||||| |||||| ||| |||||| Sbjct: 22524 ccctggagaagggataggctacccactccactattcttgcctggagaatcccatggacag 22583 Query: 426 gggagcctggcgggctacagtcc 448 |||||||||||||||||||||| Sbjct: 22584 aggagcctggcgggctacagtcc 22606 Score = 145 bits (73), Expect = 3e-32 Identities = 145/169 (85%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||| |||||||||| || |||| ||||| ||||||||| |||||||||| Sbjct: 42331 gtaaagaatccacctgcaatgcaagagacccaggttcgatccctgggtcaggaagatccc 42272 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||||||||| |||||||||||||||| ||||| |||||| ||| |||||| | Sbjct: 42271 ctggagaagggaatggtgacccactccagtattcttgcctggagaatcccatggacagag 42212 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaact 476 ||||||||||||||||||||| | | || | ||||||||||||| |||| Sbjct: 42211 gagcctggcgggctacagtccatggagtcgcaaagagttggatataact 42163 Score = 139 bits (70), Expect = 2e-30 Identities = 124/142 (87%) Strand = Plus / Plus Query: 304 aatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaaga 363 |||||||||||||| ||||||||||| ||||| | ||||| ||||||||| ||||||| Sbjct: 33563 aatggtaaagaatccgcctgcaatgcgggaaatctgggtttgatccctgggttgggaaga 33622 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || || |||||||||||||||||| ||||||||||||| ||||| |||||| ||| |||| Sbjct: 33623 tctcctggagaagggaatggctactcactccagtattcttgcctggagaattccatggac 33682 Query: 424 aggggagcctggcgggctacag 445 || ||| ||||| ||||||||| Sbjct: 33683 agaggaacctggtgggctacag 33704 Score = 121 bits (61), Expect = 4e-25 Identities = 91/101 (90%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| |||||||||||||||| |||| Sbjct: 77074 tccctgggtcgggaagatcccctggaggagggcatggcaacccactccagtattcttgcc 77133 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtc 447 | |||||| ||| |||||| ||||||||||||||||||||| Sbjct: 77134 tggagaatcccatggacagaggagcctggcgggctacagtc 77174 Score = 115 bits (58), Expect = 3e-23 Identities = 103/118 (87%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||| ||||||| | | ||| ||||||| ||| ||||| ||||||||||| Sbjct: 83936 gtaaagaatctgccagcaatgcggaagacctgggttcaatccttgggttgggaagatccc 83995 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 | ||||||||||| |||||||||||||||||||| |||| |||||| ||| |||||| Sbjct: 83996 ctggagaagggaaaggctacccactccagtattctggcctggagaattccatggacag 84053 Score = 113 bits (57), Expect = 1e-22 Identities = 105/121 (86%) Strand = Plus / Plus Query: 320 cctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggga 379 |||||| ||| | ||||||||||||||||||||||| ||||||||||| |||||| ||| Sbjct: 75548 cctgcagtgcggcaaacccgggttcagtccctgggttaggaagatcccctggagaaagga 75607 Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcggg 439 |||| | ||| |||||||||| ||||| |||||| ||| |||||| ||||||||||||| Sbjct: 75608 gtggcaatccagtccagtattcttgcctggagaattccatggacagaggagcctggcggg 75667 Query: 440 c 440 | Sbjct: 75668 c 75668 Score = 109 bits (55), Expect = 2e-21 Identities = 159/191 (83%), Gaps = 2/191 (1%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||| |||||| |||||||| | | | | ||||||| ||||||||| ||||||||||| Sbjct: 64709 taaagcatctgcatgcaatgcagaagatctgggttcaatccctgggtcaggaagatcccc 64650 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||||||| |||||| ||||||||||| |||| ||||| |||||| ||| |||| | || Sbjct: 64649 tggagaaggaaatggcaacccactccagaattcttgcctggagaatcccatggacggagg 64590 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgactcac 488 ||||||| ||||||||| || | |||| ||||||| ||| ||||||| ||||||| | Sbjct: 64589 agcctggtgggctacagcccgtggggtcacaaagagtcggacacaactg-agcgact-tc 64532 Query: 489 actttcacttt 499 ||||||||||| Sbjct: 64531 actttcacttt 64521 Score = 109 bits (55), Expect = 2e-21 Identities = 112/131 (85%) Strand = Plus / Plus Query: 318 tgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaagg 377 |||||||||||| ||| ||| |||||| ||||||||| |||||||||||| |||||||| Sbjct: 35731 tgcctgcaatgccggagacctaggttcaatccctgggtcgggaagatcccctggagaagg 35790 Query: 378 gaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcg 437 |||||| |||||||||||| || ||||| || ||| ||| |||||| ||||||||| Sbjct: 35791 caatggcaccccactccagtactcttgcctggaaaatcccatggacagaggagcctggta 35850 Query: 438 ggctacagtcc 448 ||||||||||| Sbjct: 35851 ggctacagtcc 35861 Score = 107 bits (54), Expect = 6e-21 Identities = 111/130 (85%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||| || ||| |||| ||||| ||||| ||| || ||||| Sbjct: 30907 ggtaaagaatctgcctgcatggcaggagacccaggttcgatccctaggtcaagatgatcc 30848 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||||||||||||||||||||||||||| ||| ||||| |||||| ||| |||||| Sbjct: 30847 cctggagaagggaatggctacccactccagtgttcttgcctggagaattccatggacaga 30788 Query: 427 ggagcctggc 436 |||||||||| Sbjct: 30787 ggagcctggc 30778 Score = 107 bits (54), Expect = 6e-21 Identities = 102/118 (86%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 27257 tggtaaagaatctgcctgcaatttgggagacctgggttcgatccctgggttgggaagatc 27198 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| |||||| |||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 27197 ccctggagaaaggaaaggctacccactccagtattctggcctggagaattccatggac 27140 Score = 97.6 bits (49), Expect = 6e-18 Identities = 85/97 (87%) Strand = Plus / Plus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| |||||||| || |||||||| |||||| |||||||||||||||| ||||| Sbjct: 58897 ccctgggttgggaagattgcctggagaaggaaatggcaacccactccagtattcttgcct 58956 Query: 408 agagaataccacggacaggggagcctggcgggctaca 444 |||||| ||| |||||| |||||||||| ||||||| Sbjct: 58957 ggagaatcccatggacagaggagcctggcaggctaca 58993 Score = 95.6 bits (48), Expect = 2e-17 Identities = 84/96 (87%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| ||| | | |||| |||| | ||||||||| |||||||| Sbjct: 56450 tggtaaagaatctgcctgcagtgcagaagaccctggtttaatccctgggtcaggaagatc 56509 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| |||||||||||||||||||| Sbjct: 56510 ccccagagaagggataggctacccactccagtattc 56545 Score = 93.7 bits (47), Expect = 1e-16 Identities = 77/87 (88%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| ||||||||||||| |||||| || | ||||||||| || Sbjct: 29864 atggtaaagaatctgcctgaaatgctggaaacctgggttccatctccaggtggggaatat 29923 Query: 365 cccccggagaagggaatggctacccac 391 | || |||||||||||||||||||||| Sbjct: 29924 ctcctggagaagggaatggctacccac 29950 Score = 91.7 bits (46), Expect = 4e-16 Identities = 88/102 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||| |||| ||||| |||||||||||||||| |||| Sbjct: 36732 tccctgggttaggaagatcccctggaggagggcatggccacccactccagtattcttgcc 36791 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| | |||||| ||||||||| |||||||||||| Sbjct: 36792 tggagaatcctgtggacagaggagcctggtgggctacagtcc 36833 Score = 85.7 bits (43), Expect = 2e-14 Identities = 94/111 (84%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||| || ||||||||| |||||||||||| |||| ||| ||||| |||||||| ||| Sbjct: 47572 cgggtccaatccctgggttgggaagatcccctggaggaggtcatggcaacccactctagt 47513 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 |||| ||||| ||| || ||| |||||| |||| |||| |||||||||||| Sbjct: 47512 attcttgcctggaggattccatggacagaggagtctggtgggctacagtcc 47462 Score = 85.7 bits (43), Expect = 2e-14 Identities = 76/87 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| |||| ||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 31088 ggaggagggcatggcaacccactccagtattcttgcctggagaatcccatggacagagga 31029 Query: 430 gcctggcgggctacagtccctagggtt 456 |||||| ||||| |||||| ||||||| Sbjct: 31028 gcctggtgggctgcagtccatagggtt 31002 Score = 81.8 bits (41), Expect = 4e-13 Identities = 92/109 (84%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||| ||||||||||| ||||| |||||| ||| ||||| || Sbjct: 34801 ggagaaggaaatggcaaccccctccagtattcttgcctggagaattccatagacagaaga 34860 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 || ||| |||||| ||||| | |||||| ||||||||||| |||||||| Sbjct: 34861 gcttggtgggctatagtccatggggttgcaaagagttggacacaactga 34909 Score = 77.8 bits (39), Expect = 6e-12 Identities = 78/91 (85%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| ||| |||| | |||| |||||||||||||||| ||||| |||||| | Sbjct: 50158 ggaagatcccctggaaaaggaactggcaacccactccagtattcttgcctggagaatttc 50099 Query: 418 acggacaggggagcctggcgggctacagtcc 448 |||||| |||||||||| ||||||||||| Sbjct: 50098 ctggacagaggagcctggctggctacagtcc 50068 Score = 73.8 bits (37), Expect = 9e-11 Identities = 142/173 (82%), Gaps = 3/173 (1%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||| ||||||||||||||| ||| ||| ||||| ||||||| |||| ||||||| Sbjct: 57715 ggtaaaggatctgcctgcaatgcaggagacctgggtttgatccctggatggg-aagatcc 57773 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaatacc-acggacag 425 | |||| |||| || || | ||||| |||||||| |||| |||||| || | |||||| Sbjct: 57774 ct-ggaggagggcatagcaatccacttcagtattctcgcctggagaatccccatggacag 57832 Query: 426 gggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 ||||||||| |||||||||||| | |||| ||||||| |||||||||||| Sbjct: 57833 aggagcctggtgggctacagtccatggggtcacaaagagtcggatacaactga 57885 Score = 71.9 bits (36), Expect = 4e-10 Identities = 78/92 (84%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| |||||||| |||||| || ||||||||||| ||||| Sbjct: 69138 cctgggtcgggaagatcccctggagaaggaaatggcaacatgctccagtattcttgcctg 69079 Query: 409 gagaataccacggacaggggagcctggcgggc 440 || ||| ||| |||||| ||||||||| |||| Sbjct: 69078 gaaaatcccatggacagaggagcctggtgggc 69047 Score = 71.9 bits (36), Expect = 4e-10 Identities = 102/124 (82%) Strand = Plus / Plus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| |||||||| ||||| |||||||||||||||| ||| | ||||| | || Sbjct: 46874 gatcccctggagaaggccatggcaacccactccagtattcttgcttggagaaccctttgg 46933 Query: 422 acaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagc 481 |||| |||||||||| |||||||||| |||||| | ||||||| || || |||||||| Sbjct: 46934 acagaggagcctggcaggctacagtctatagggtcgcaaagagtcagacacgactgaagc 46993 Query: 482 gact 485 |||| Sbjct: 46994 gact 46997 Score = 69.9 bits (35), Expect = 1e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||||||| |||||| |||| ||||||||||| ||||| | ||| | | Sbjct: 91504 gaagatcccctggagaaggaaatggcaaccctctccagtattcttgcctgggaaatccta 91445 Query: 419 cggacaggggagcctggcgggctacagtccctagggttg 457 |||||| |||| ||||| ||||||||||| | |||||| Sbjct: 91444 tggacagaggagtctggcaggctacagtccatggggttg 91406 Score = 69.9 bits (35), Expect = 1e-09 Identities = 56/63 (88%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 |||||||||||||| || |||||||||||| ||||||| ||| ||| ||||| ||||||| Sbjct: 53359 gggttcagtccctgtgttgggaagatcccctggagaagagaaaggccacccagtccagta 53418 Query: 399 ttc 401 ||| Sbjct: 53419 ttc 53421 Score = 69.9 bits (35), Expect = 1e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||||| Sbjct: 93139 agaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacaggggagc 93080 Query: 432 ctg 434 ||| Sbjct: 93079 ctg 93077 Score = 67.9 bits (34), Expect = 6e-09 Identities = 52/58 (89%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||| ||| |||| |||||| |||||||||||||||||||| ||||||||||| Sbjct: 56619 gggaagattccctggaggagggaaaggctacccactccagtattctggcctagagaat 56676 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Plus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| |||||||||||| |||| ||| |||||| ||||| |||||||||| ||||| Sbjct: 85426 ccctgggtcgggaagatcccctggaggaggaaatggcaacccaatccagtattcttgcct 85485 Query: 408 agagaa 413 ||||| Sbjct: 85486 ggagaa 85491 Score = 65.9 bits (33), Expect = 2e-08 Identities = 78/93 (83%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 ||||||||||||| || ||||| | ||| |||||||||| ||||||||| |||||||| Sbjct: 44210 acccactccagtactcttgcctgaaaaatcccacggacagaggagcctggtaggctacag 44151 Query: 446 tccctagggttgaaaagagttggatacaactga 478 ||| | ||| || ||||||| ||| |||||||| Sbjct: 44150 tccatggggatgcaaagagtcggacacaactga 44118 Score = 65.9 bits (33), Expect = 2e-08 Identities = 54/61 (88%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||| |||||||||||| |||||||| |||||| ||||||||||||| || |||| Sbjct: 58002 tccctgggctgggaagatcccctggagaaggaaatggcaacccactccagtactcttgcc 58061 Query: 407 t 407 | Sbjct: 58062 t 58062 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 31608 ggagaaggaaatggcaacccactccagtgttcctgcctggagaatcccaaggatggggga 31667 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 31668 gcctggtgggct 31679 Score = 63.9 bits (32), Expect = 9e-08 Identities = 41/44 (93%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 53260 ggaagatcccctggagaagggataggctacccactccagtattc 53303 Score = 63.9 bits (32), Expect = 9e-08 Identities = 136/169 (80%), Gaps = 5/169 (2%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgca-atgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||| |||| |||| ||| ||| ||||||||||||||||| | ||||| Sbjct: 65445 tggtaaagaatctggctgcctatgcaggagacctgggttcagtccctgggtcagaaagat 65386 Query: 365 cccccggagaagggaatggctacccac----tccagtattcatgcctagagaataccacg 420 || |||||||| |||||| |||||| ||||||||| | |||||||||| | | | Sbjct: 65385 ttcctggagaaggaaatggcaacccacccactccagtatttttacctagagaatcctatg 65326 Query: 421 gacaggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||| | ||||||| ||||| ||||| |||||| ||||||||||| Sbjct: 65325 gacagagaagcctggtgggctgtagtccacggggttgcaaagagttgga 65277 Score = 61.9 bits (31), Expect = 3e-07 Identities = 112/135 (82%), Gaps = 3/135 (2%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaa-acccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||| |||| ||||| ||| ||||| |||||||| ||||||||||| Sbjct: 80566 taaagaatctgcctgtaatg-tggaagacctgggtttgatccctggggtgggaagatccc 80624 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaatacc-acggacagg 426 | |||| |||| | ||| | |||| | ||| ||| ||||| |||||| || |||||||| Sbjct: 80625 ctggaggagggcacggcaagccaccctagtgttcttgcctggagaatccctacggacaga 80684 Query: 427 ggagcctggcgggct 441 ||||||||||||||| Sbjct: 80685 ggagcctggcgggct 80699 Score = 60.0 bits (30), Expect = 1e-06 Identities = 66/78 (84%) Strand = Plus / Plus Query: 324 caatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaagggaatgg 383 |||||| ||| || ||||||| ||||||||| |||||||||||| |||| |||| | | Sbjct: 82045 caatgcgggagacacgggttcgatccctgggtcgggaagatcccctggaggagggcacag 82104 Query: 384 ctacccactccagtattc 401 | |||||||||||||||| Sbjct: 82105 caacccactccagtattc 82122 Score = 60.0 bits (30), Expect = 1e-06 Identities = 90/110 (81%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||| || |||||||||||| | || |||| ||||| |||||| ||| || Sbjct: 94983 gggttcaatccctaagttgggaagatcccctgaaggagggcatggcaacccaccccaata 94924 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| ||||| |||||| ||| | | | ||||||||| |||||||||||| Sbjct: 94923 ttcttgcctggagaatcccatgaatggaggagcctggtgggctacagtcc 94874 Score = 58.0 bits (29), Expect = 5e-06 Identities = 74/89 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| ||| |||| ||||| |||| ||||| |||| |||| Sbjct: 70415 tccctgggtcgggaagatcccctggaagagggcatggcagcccattccagaattcttgcc 70474 Query: 407 tagagaataccacggacaggggagcctgg 435 | ||||| ||| |||||| ||||||||| Sbjct: 70475 tgaagaatcccatggacagaggagcctgg 70503 >gb|CM000201| Bos taurus chromosome 25-FRAG[8910000,9009999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 144/161 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||||||||| ||||||||| |||||||| Sbjct: 91837 atggtaaagaatctgcctgcaatgcaggagacccgggttcgatccctgggttgggaagat 91778 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| |||| |||||| ||| ||||| Sbjct: 91777 cccctggagaagggaatggctacccactccagtattctggcctggagaatgccatggaca 91718 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||||||| ||||||||||| | |||| | ||||||| Sbjct: 91717 gaggagcctggcaggctacagtccatggggtcgcaaagagt 91677 Score = 125 bits (63), Expect = 3e-26 Identities = 144/171 (84%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||| ||||||||| |||||| ||| || | ||||| ||||||||| ||||||| Sbjct: 20192 atggtaatgaatctgcccacaatgcgggagactcaggttcgatccctgggtcaggaagat 20133 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| ||| |||||| ||| ||||| Sbjct: 20132 cccctggagaagggaatggctacccactccagtattctcacctggagaattccatggaca 20073 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaac 475 | |||||||||| ||||||||| | | |||| ||||||||||| ||||| Sbjct: 20072 gaggagcctggcaggctacagttcatggggtcacaaagagttggacacaac 20022 Score = 117 bits (59), Expect = 7e-24 Identities = 89/99 (89%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||||||||||||||||| |||| ||| ||| || |||||||||||||||| |||| Sbjct: 39172 tccctgggtggggaagatcccctggagcaggaaatagcaacccactccagtattcttgcc 39231 Query: 407 tagagaataccacggacaggggagcctggcgggctacag 445 | |||||| ||| |||||| ||||||||||||||||||| Sbjct: 39232 tggagaatcccatggacagaggagcctggcgggctacag 39270 Score = 111 bits (56), Expect = 4e-22 Identities = 123/144 (85%), Gaps = 1/144 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||| ||||||| |||||||||| ||| | || |||||| ||||||||| |||||||| Sbjct: 16555 tggtgaagaatccacctgcaatgcaggagatccaggttcaatccctgggtcgggaagatt 16496 Query: 366 cccc-ggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || ||||| ||||||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 16495 ctcctggagatgggaatggcaacccactccagtattcttgcctggagaattccatggaca 16436 Query: 425 ggggagcctggcgggctacagtcc 448 | ||| |||||||||| ||||||| Sbjct: 16435 gaggaacctggcgggcgacagtcc 16412 Score = 111 bits (56), Expect = 4e-22 Identities = 113/132 (85%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| ||| |||||||||| |||||||||||||| | |||| Sbjct: 60430 tccctgggttgggaagatcccctagaggagggaatggcaacccactccagtatccttgcc 60489 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| |||||||||| ||||||||| ||| |||||||| ||||| |||||||| Sbjct: 60490 tggagaatcccacggacagaggagcctggtgggatacagtccagagggtcacaaagagtt 60549 Query: 467 ggatacaactga 478 ||| || ||||| Sbjct: 60550 ggacacgactga 60561 Score = 101 bits (51), Expect = 4e-19 Identities = 95/107 (88%), Gaps = 2/107 (1%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaa-acccgggttcagtccctgggtggggaagatccc 367 ||||| ||||||||| |||| ||||| |||| |||||||||||||||| ||||||||||| Sbjct: 40894 taaagcatctgcctggaatg-tggaagacccaggttcagtccctgggtcgggaagatccc 40836 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat 414 | |||||||| |||||| ||||||||||||| || ||||| |||||| Sbjct: 40835 ctggagaaggaaatggcaacccactccagtactcttgcctggagaat 40789 Score = 91.7 bits (46), Expect = 4e-16 Identities = 142/174 (81%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| ||||||| |||||| || |||| |||||| ||||||||| |||||||| Sbjct: 75911 atggtaaagcgtctgcctacaatgcaagagacccaggttcaatccctgggtcgggaagat 75852 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || |||||||| ||||| |||||||||||||||| ||||| || ||| ||| |||| Sbjct: 75851 ctcctggagaaggaaatggtaacccactccagtattcttgcctggaaaatcccatggacc 75792 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | ||||||| ||||||||| || | |||| | ||||||| ||| || ||||| Sbjct: 75791 aagaagcctggtgggctacaggccatggggtcgcaaagagtcggacacgactga 75738 Score = 85.7 bits (43), Expect = 2e-14 Identities = 89/103 (86%), Gaps = 1/103 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| ||||||||||||||| |||| Sbjct: 32237 tccctgggttgggaagatcccctggaggagggcatggcagcccactccagtattcttgcc 32296 Query: 407 tagagaat-accacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||||| |||||||||| | ||||||||| Sbjct: 32297 tggagaatccccatggacagaggagcctggcagactacagtcc 32339 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 377 ggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggc 436 |||||||| |||||||||||| ||| ||||| |||||| |||||||||| ||||||||| Sbjct: 84340 ggaatggcgacccactccagttttcttgcctggagaatcccacggacagaggagcctggt 84399 Query: 437 gggctacagtcc 448 ||||| |||||| Sbjct: 84400 gggctccagtcc 84411 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 67698 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 67757 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 67758 gcctggtgggct 67769 Score = 79.8 bits (40), Expect = 1e-12 Identities = 109/132 (82%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| ||| |||||| |||||||||||||| |||| Sbjct: 62593 tccctgggttgggaagatcccctggaggaggaaatggcagtccactccagtattcctgcc 62652 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| | | |||| | ||||||||| ||||||| || |||||| | |||||||| Sbjct: 62653 tggagaatcctatggactgaggagcctggtgggctacggtttgtagggtcgcaaagagtt 62712 Query: 467 ggatacaactga 478 | | |||||||| Sbjct: 62713 gaacacaactga 62724 Score = 73.8 bits (37), Expect = 9e-11 Identities = 91/109 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| ||| |||| ||||| |||||||||||||||| |||| Sbjct: 85575 tccctgggtcaggaagatccccaagaggagggcatggcaacccactccagtattcttgcc 85634 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 | |||||| ||| |||| |||| |||| |||||| ||||| |||||| Sbjct: 85635 tggagaatcccatggaccaaggagtctggagggctatagtccatagggt 85683 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 19076 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 19135 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 19136 gcctggtgggct 19147 Score = 71.9 bits (36), Expect = 4e-10 Identities = 108/132 (81%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||| |||||||||||| |||| ||| ||| ||||| ||||||||| ||||||| Sbjct: 77387 atggtacagaatctgcctgtaatgtgggagacctgggtttgatccctgggtcaggaagat 77446 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||||| | |||||| ||||||| ||||||| ||||| |||||| ||| ||||| Sbjct: 77447 cccttggagaaagaaatggcaacccacttaagtattcttgcctggagaatcccatggaca 77506 Query: 425 ggggagcctggc 436 |||||||||| Sbjct: 77507 aaggagcctggc 77518 Score = 69.9 bits (35), Expect = 1e-09 Identities = 68/79 (86%) Strand = Plus / Minus Query: 320 cctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggga 379 |||||||||| ||| | || ||||| | |||||||||||||||||| | |||||||||| Sbjct: 16657 cctgcaatgcaggagaacccagttcaattcctgggtggggaagatccactggagaaggga 16598 Query: 380 atggctacccactccagta 398 ||||||||||||||||| Sbjct: 16597 taggctacccactccagta 16579 Score = 69.9 bits (35), Expect = 1e-09 Identities = 87/103 (84%), Gaps = 1/103 (0%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||| ||| |||| ||| |||||| ||||||||||| |||| |||| Sbjct: 86002 tccctgggtcgggaagattccctggaggaggaaatggcaacccactccagaattcttgcc 85943 Query: 407 tag-agaataccacggacaggggagcctggcgggctacagtcc 448 | | | ||| ||| ||| || |||||||||| ||||||||||| Sbjct: 85942 tggaaaaatcccatggaaagaggagcctggcaggctacagtcc 85900 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||| ||||||| |||||||||| |||||||||||||||| ||| ||||| |||||| | Sbjct: 9350 gggacgatcccctggagaagggataggctacccactccagtgttcttgcctggagaatcc 9291 Query: 417 cacggacaggggagcctggcgggctacagtc 447 || | ||| |||||| |||||||| ||||| Sbjct: 9290 catgaacacaggagcccggcgggctgcagtc 9260 Score = 65.9 bits (33), Expect = 2e-08 Identities = 114/141 (80%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||||||||| ||| ||| ||||| || |||| ||||||| || Sbjct: 49753 gtaaagaatctgcctgcaatgtgggagacctgggtttgatcttggggtcaggaagattcc 49694 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||| ||||| ||||| | |||||||||||| | ||||| |||||| ||| |||||| | Sbjct: 49693 ctggataagggcatggcaatccactccagtatacttgcctggagaatcccatggacagag 49634 Query: 428 gagcctggcgggctacagtcc 448 ||||||| ||| |||||||| Sbjct: 49633 aagcctggtgggttacagtcc 49613 Score = 65.9 bits (33), Expect = 2e-08 Identities = 72/85 (84%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||| |||||||| ||| ||| ||||| ||||||||| ||||||| || Sbjct: 12487 gtaaagaatctgcttgcaatgcaggagaccagggtttgatccctgggtcaggaagattcc 12428 Query: 368 ccggagaagggaatggctacccact 392 | |||||| |||||||| ||||||| Sbjct: 12427 ctggagaatggaatggcaacccact 12403 Score = 63.9 bits (32), Expect = 9e-08 Identities = 81/96 (84%), Gaps = 1/96 (1%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||| |||||||||| ||| |||| |||| | |||||| ||||||||| Sbjct: 38100 tggtaaagaatct-cctgcaatgcaggagaccccggtttgattgctgggtcgggaagatc 38042 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | ||||||||||| ||||||||||||||||||| Sbjct: 38041 tgctggagaagggaaaagctacccactccagtattc 38006 Score = 61.9 bits (31), Expect = 3e-07 Identities = 73/87 (83%) Strand = Plus / Plus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| | ||||||||| |||| ||| |||||||||||||||||| ||| || || | Sbjct: 42730 ctgggttgagaagatcccttggaggaggacatggctacccactccagtgttcttgactgg 42789 Query: 410 agaataccacggacaggggagcctggc 436 ||||| ||| |||||| |||||||||| Sbjct: 42790 agaatcccatggacagaggagcctggc 42816 Score = 60.0 bits (30), Expect = 1e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 |||||||||||||||| ||||| |||||| ||| |||||| ||||||||| Sbjct: 61670 acccactccagtattcttgcctggagaatcccatggacagaggagcctgg 61621 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 4980 ggagaaggcaatggcaacccactccagtgttcttgcctggagaatcccagggacggagga 4921 Query: 430 gcctgg 435 |||||| Sbjct: 4920 gcctgg 4915 Score = 58.0 bits (29), Expect = 5e-06 Identities = 74/89 (83%) Strand = Plus / Plus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||| | ||||||||||| |||| |||| ||||| ||||||||| |||||| ||||| Sbjct: 85072 ccctggttcgggaagatcccttggaggagggtatggcaacccactccggtattcttgcct 85131 Query: 408 agagaataccacggacaggggagcctggc 436 || ||| ||| |||||| ||||||||| Sbjct: 85132 ggaaaatcccatggacagaagagcctggc 85160 >gb|CM000190| Bos taurus chromosome 14-FRAG[9450000,9549999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 129/141 (91%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| Sbjct: 14921 gtaaagaatctgcctgcaatgctggagacccgggtttggtccctgggtggggaagatccc 14980 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||||||||||||||||||||||||||| |||||| ||||| ||| |||| || Sbjct: 14981 ctggagaagggaatggctacccactccagtattcttgcctatagaatcccatggacggga 15040 Query: 428 gagcctggcgggctacagtcc 448 |||||||| ||| |||||||| Sbjct: 15041 gagcctggtgggatacagtcc 15061 Score = 129 bits (65), Expect = 2e-27 Identities = 126/145 (86%), Gaps = 1/145 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| ||| |||||||||||| ||| |||||||| Sbjct: 30669 atggtaaagaatctgcctgcagtgcgggagacctgggttcagtccccaggttgggaagat 30728 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||| | || ||||||||||||| ||||||||| || | | ||||| Sbjct: 30729 cccctggagaagggaatgacaactcactccagtattcttgcctagaggat-ctatggaca 30787 Query: 425 ggggagcctggcgggctacagtccc 449 | | ||||||| ||||||||||||| Sbjct: 30788 gagaagcctggggggctacagtccc 30812 Score = 125 bits (63), Expect = 3e-26 Identities = 124/143 (86%), Gaps = 1/143 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||| ||| ||| ||| |||||| | ||||||| ||||||||| Sbjct: 63090 ggtaaagaatctgcctgcagtgcaggagacctgggttcgattcctgggtcaggaagatcc 63149 Query: 367 cccggagaagggaatggct-acccactccagtattcatgcctagagaataccacggacag 425 || |||||||||||||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 63150 cctggagaagggaatggctaacccactccagtattcttgcctggagaatcccatggacag 63209 Query: 426 gggagcctggcgggctacagtcc 448 ||||| ||| ||| |||||||| Sbjct: 63210 aggagcttggtgggttacagtcc 63232 Score = 117 bits (59), Expect = 7e-24 Identities = 123/143 (86%), Gaps = 1/143 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||| ||||||| ||| ||| |||||| ||||||| | | |||||||| Sbjct: 78615 ggtaaagaatctgccagcaatgcaggagacctgggttccatccctggattgcgaagatcc 78674 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggacag 425 || ||||||||| ||| | |||||||||||||||| ||||| |||||| ||| || ||| Sbjct: 78675 cctggagaagggcatgacaacccactccagtattcttgcctggagaatccccatgggcag 78734 Query: 426 gggagcctggcgggctacagtcc 448 |||||||||||||||||||||| Sbjct: 78735 aggagcctggcgggctacagtcc 78757 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||| ||| |||||||||||| ||||||| ||| |||||||||||||||||||| |||| Sbjct: 47785 tcccttggtagggaagatcccctggagaagagaaaggctacccactccagtattcttgcc 47726 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 |||||||| | | | |||| ||||||||| |||||||||||| | |||||| ||||||| Sbjct: 47725 tagagaatcctatgaacagaggagcctggtgggctacagtccatggggttgcaaagagt 47667 Score = 109 bits (55), Expect = 2e-21 Identities = 94/107 (87%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| |||||| || ||||||||||| ||||||||||||||| ||||||||||||||| Sbjct: 17488 gttcaatccctgagtcaggaagatcccctggagaagggaatggcaacccactccagtatt 17547 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtc 447 | ||||| ||||| ||| |||||| ||||||||| ||||||||||| Sbjct: 17548 cttgcctgaagaattccatggacagaggagcctggtgggctacagtc 17594 Score = 109 bits (55), Expect = 2e-21 Identities = 82/91 (90%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||| |||||| ||| | ||||||||| ||||||||| ||||||||||| Sbjct: 67226 gtaaagaatctgcctacaatgcaggagatccgggttcaatccctgggtagggaagatccc 67167 Query: 368 ccggagaagggaatggctacccactccagta 398 | |||||||| |||||| ||||||||||||| Sbjct: 67166 ctggagaaggaaatggcaacccactccagta 67136 Score = 107 bits (54), Expect = 6e-21 Identities = 90/102 (88%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| ||| ||| |||||| |||||||||||||||| |||| Sbjct: 1300 tccctgggttgggaagatcccctggaataggaaatggcaacccactccagtattcttgcc 1359 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | || ||| |||||||||| ||||||||| |||||||||||| Sbjct: 1360 tggaaaattccacggacagaggagcctggtgggctacagtcc 1401 Score = 107 bits (54), Expect = 6e-21 Identities = 93/106 (87%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||| |||||||||| ||| ||| ||||||| || |||||| |||||||||||| Sbjct: 59761 taaagaatccacctgcaatgcaggagaccggggttcaatctctgggttgggaagatcccc 59820 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||||| |||||||||||||||||||| |||| |||||| Sbjct: 59821 tggagaagggaaaggctacccactccagtattctggcctggagaat 59866 Score = 101 bits (51), Expect = 4e-19 Identities = 108/127 (85%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| |||| ||||| | ||||||| ||| ||||||| Sbjct: 80759 gtaaagaatctgcctgcaatgcaggagacccaggttcgattcctgggttggggagatccc 80700 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| ||| | || ||||||||||||| |||||| ||| |||||| | Sbjct: 80699 ctggagaaggaaatggcaacctattctagtattcatgcctggagaatcccatggacagag 80640 Query: 428 gagcctg 434 |||||| Sbjct: 80639 cagcctg 80633 Score = 97.6 bits (49), Expect = 6e-18 Identities = 94/109 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 55961 tggtaaagaatctgcctgcaatgcaggagacctgggttcgatccctgggttgggaagatc 56020 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 || ||| ||| ||| ||||||| |||||||||||| |||| |||||| Sbjct: 56021 ccttggaaaagagaaaggctaccgactccagtattctggcctggagaat 56069 Score = 93.7 bits (47), Expect = 1e-16 Identities = 101/119 (84%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| ||||||||||||| | |||| Sbjct: 71819 tccctgggttgggaagatcccctggaggagggcatggcagcccactccagtatacttgcc 71760 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| ||| |||||| ||||||||| |||||| ||||| | |||| | ||||||| Sbjct: 71759 tggagaatcccatggacagaggagcctggtgggctatagtccatggggtcgcaaagagt 71701 Score = 91.7 bits (46), Expect = 4e-16 Identities = 94/110 (85%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||||||| ||||| | ||||||||| |||||| |||| ||||||||||| |||| Sbjct: 86936 gggttcagtccttgggttgagaagatcccttggagaatggaagagctacccactctagta 86877 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| |||| |||||| ||| |||||| |||||||||| ||||||||||| Sbjct: 86876 ttctggcctggagaattccatggacagaggagcctggcaggctacagtcc 86827 Score = 89.7 bits (45), Expect = 2e-15 Identities = 69/77 (89%) Strand = Plus / Minus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 ||||||||||||| || ||||||||||||| ||||| |||||| ||| |||||| ||||| Sbjct: 61081 agaagggaatggcaacacactccagtattcttgcctggagaattccatggacagaggagc 61022 Query: 432 ctggcgggctacagtcc 448 |||| |||||||||||| Sbjct: 61021 ctggtgggctacagtcc 61005 Score = 87.7 bits (44), Expect = 6e-15 Identities = 104/124 (83%) Strand = Plus / Minus Query: 325 aatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaagggaatggc 384 ||||| ||| |||| |||||| ||||||||| ||||||||| || |||||||| |||||| Sbjct: 80438 aatgcgggagacccaggttcaatccctgggtcgggaagatctcctggagaaggaaatggc 80379 Query: 385 tacccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctaca 444 |||||||||||||||| ||||| || ||| ||| ||| | ||| ||||| ||||||| Sbjct: 80378 aacccactccagtattcttgcctggaaaatcccatggatggtggaacctggtaggctaca 80319 Query: 445 gtcc 448 |||| Sbjct: 80318 gtcc 80315 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 22613 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacagagga 22554 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 22553 gcctggggggct 22542 Score = 75.8 bits (38), Expect = 2e-11 Identities = 79/90 (87%), Gaps = 2/90 (2%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcct-agagaatac 416 ||||||||||| |||||||| |||||| |||||||||||||||| | ||| ||| ||| | Sbjct: 85503 ggaagatcccctggagaaggaaatggcaacccactccagtattcttacctgaga-aatcc 85561 Query: 417 cacggacaggggagcctggcgggctacagt 446 || |||||| ||||||||| |||||||||| Sbjct: 85562 catggacagaggagcctggtgggctacagt 85591 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 42820 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 42761 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 42760 gcctggtgggct 42749 Score = 69.9 bits (35), Expect = 1e-09 Identities = 83/98 (84%), Gaps = 2/98 (2%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| ||| |||| ||| | |||||||||||||| | |||| Sbjct: 6539 tccctgggtcaggaagatccccaggaagagggcatgacaacccactccagtatgcttgcc 6480 Query: 407 tagagaataccacggacaggggagcctggcgggctaca 444 |||||||| ||| ||||| ||||||||| |||||||| Sbjct: 6479 tagagaatcccatggaca--ggagcctggtgggctaca 6444 Score = 69.9 bits (35), Expect = 1e-09 Identities = 122/151 (80%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||| ||||||| || ||| || | |||| ||||||| | ||||||| Sbjct: 97446 atggtaaagaatccacctgcaacgcaggagacacaggtttgatccctggttcaggaagat 97505 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||| |||| ||||| | | ||||||||||| || || |||||| ||||||||| Sbjct: 97506 cccctggaggagggcatggcaatctgctccagtattcttgtctggagaatcccacggaca 97565 Query: 425 ggggagcctggcgggctacagtccctagggt 455 | ||| ||||| |||||| ||||| |||||| Sbjct: 97566 gaggaacctggagggctatagtccatagggt 97596 Score = 67.9 bits (34), Expect = 6e-09 Identities = 64/74 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| | || ||||| | ||||||| ||||||||| Sbjct: 73236 tggtaaagaatctgcctgcaatgcaggagaacccggttccattcctgggtcgggaagatc 73295 Query: 366 ccccggagaaggga 379 | | |||||||||| Sbjct: 73296 cactggagaaggga 73309 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||| | Sbjct: 49951 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggca 49892 Query: 430 gcctgg 435 |||||| Sbjct: 49891 gcctgg 49886 Score = 65.9 bits (33), Expect = 2e-08 Identities = 132/165 (80%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||| |||||||||||||||||||| | | |||| | | || |||||| || ||||||| Sbjct: 15922 atggcaaagaatctgcctgcaatgcagaagacccagttccaatccctgtgttgggaagag 15863 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 || ||||||||||| ||| |||||||||||||||| | ||| ||| || ||| || | Sbjct: 15862 tccttggagaagggaacggcaacccactccagtattctttcctggaggattccatcgata 15803 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | |||| |||| |||||||| ||| | |||| ||||||||||| Sbjct: 15802 gaggagactggtgggctacactccatggggtcacaaagagttgga 15758 Score = 63.9 bits (32), Expect = 9e-08 Identities = 53/60 (88%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||| ||| |||||||| |||||| |||||||||||| Sbjct: 55652 gggttcaatccctgggttgggaagattccctggagaaggaaatggcaccccactccagta 55593 Score = 63.9 bits (32), Expect = 9e-08 Identities = 41/44 (93%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 8403 ggaagatcccctggagaagggataggctacccactccagtattc 8446 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||| || ||| ||||| |||||| ||| |||| ||||| Sbjct: 35889 ggagaaggaaatggcaacccactcccgtgttcttgcctggagaatcccagggacggggga 35830 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 35829 gcctggtgggct 35818 Score = 60.0 bits (30), Expect = 1e-06 Identities = 103/126 (81%), Gaps = 1/126 (0%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaaga-tcccccggagaagggaatggctacccactccagtat 399 ||||||| ||||||| ||||||| ||||| |||| |||| | ||| |||||||||||| | Sbjct: 5465 gttcagttcctgggttgggaagagtcccctggaggagggcagggcgacccactccagtgt 5524 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || || || |||||| ||| |||||| || | || | ||||| ||||| |||||||| | Sbjct: 5525 tcttgtctggagaatcccatggacagaggtgtctagagggctgcagtctatagggttgca 5584 Query: 460 aagagt 465 |||||| Sbjct: 5585 aagagt 5590 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 76795 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 76736 Query: 430 gcctgg 435 |||||| Sbjct: 76735 gcctgg 76730 Score = 60.0 bits (30), Expect = 1e-06 Identities = 48/54 (88%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||||||| ||||||||||| | |||||||| ||||||||||| |||||||| Sbjct: 73395 tccctgggttgggaagatcccttgtagaagggactggctacccacaccagtatt 73448 Score = 60.0 bits (30), Expect = 1e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | |||||||||||| |||| ||| | || |||||||||||||||| || | Sbjct: 39845 tccctggttcgggaagatcccctggaggaggacacagcaacccactccagtattcttgtc 39786 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||| | ||| |||||| ||||||||| ||||||||||| Sbjct: 39785 tggagacttccatggacagaggagcctggaaggctacagtcc 39744 Score = 60.0 bits (30), Expect = 1e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| || || ||||| |||| |||||||||||| || |||||| ||| Sbjct: 30405 ggagaaggaaatggcaactcagtccaggattcttgcctagagaatcccgtggacagagga 30464 Query: 430 gcctggcgggctacagtccctagggt 455 |||||| ||||| | |||| |||||| Sbjct: 30465 gcctggtgggctgctgtccatagggt 30490 Score = 58.0 bits (29), Expect = 5e-06 Identities = 41/45 (91%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattc 401 |||||| ||||| |||||||||| |||||||||||||||||||| Sbjct: 30602 gggaagttcccctggagaagggataggctacccactccagtattc 30646 >gb|CM000189| Bos taurus chromosome 13-FRAG[23670000,23769999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 153/173 (88%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||| ||||||| ||| | || |||||||||||||||| |||||||| Sbjct: 43136 atggtaaagaatctgcccgcaatgcaggagatccaggttcagtccctgggttgggaagat 43077 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 43076 cccctggagaagggaatggcaacccactccagtattcttgcctggagaatcccatggaca 43017 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactg 477 | ||||||||| |||||||||||| | |||| ||||||||||| ||||||| Sbjct: 43016 gaggagcctggtgggctacagtccatggggtcacaaagagttggacacaactg 42964 Score = 127 bits (64), Expect = 7e-27 Identities = 122/140 (87%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||||||| ||| |||| |||||| ||||||||| ||||||||||| Sbjct: 26246 taaagaatctgcctgcaatgcaggagacccaggttcaatccctgggtcaggaagatcccc 26187 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||||| | ||||||| |||||||||||||| ||||| ||||| ||| |||||| || Sbjct: 26186 tggagaaagagatggcta-ccactccagtattcttgcctgaagaatcccatggacagagg 26128 Query: 429 agcctggcgggctacagtcc 448 ||||||| |||||||||||| Sbjct: 26127 agcctggtgggctacagtcc 26108 Score = 111 bits (56), Expect = 4e-22 Identities = 95/108 (87%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||||||||||||| ||| ||| |||||| ||| ||||| |||||| | Sbjct: 53716 atggtaaagagtctgcctgcaatgcaggacacctgggttcgatccttgggttgggaagtt 53775 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagaga 412 || | ||||||||||||||||||||||||||||||||| |||| |||| Sbjct: 53776 cctctggagaagggaatggctacccactccagtattcaggcctggaga 53823 Score = 109 bits (55), Expect = 2e-21 Identities = 147/175 (84%), Gaps = 2/175 (1%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| ||| || |||||||||||||| |||||||| Sbjct: 35961 atggtaaagaatctgcctgcagtgcgggagacctggcttcagtccctgggttgggaagat 36020 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggac 423 |||| | || | || ||||| |||||||| ||||||| | ||| |||||| ||| |||| Sbjct: 36021 cccctgcaggaaggcatggcaacccactctagtattc-ttcctggagaatccccatggac 36079 Query: 424 aggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 || ||||||||| |||||||||||| | |||| | ||||||| ||| || ||||| Sbjct: 36080 agaggagcctggagggctacagtccatggggtcgcaaagagtcggacacgactga 36134 Score = 107 bits (54), Expect = 6e-21 Identities = 135/162 (83%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||| ||||| || |||| ||||| |||||| || ||||||||||| Sbjct: 57038 gtaaagaatctgcccacaatgaaagagacccaggttcgatccctgagttgggaagatccc 57097 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||| ||||||||||| |||||||||||||||| || || |||||| || |||||| | Sbjct: 57098 ctggaaaagggaatggcaacccactccagtattcttggctggagaatttcagggacagag 57157 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||||| ||||||||||| | |||| | ||| ||||||| Sbjct: 57158 gagcctggcaggctacagtccatggggtagcaaatagttgga 57199 Score = 93.7 bits (47), Expect = 1e-16 Identities = 127/151 (84%), Gaps = 2/151 (1%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| ||||||||| ||| ||| ||||| ||||||||| ||||||| | Sbjct: 10764 ggtaaagaatcctcctgcaatgtgggagacctgggtttgatccctgggttgggaagacgc 10705 Query: 367 cccggagaagggaatggctacccact-ccagtattcatgcctagagaataccacggaca- 424 || ||||||||||||||| ||||||| |||||||| ||||| || ||| ||| ||||| Sbjct: 10704 cctggagaagggaatggcaacccactcccagtatttttgcctggaaaattccatggacag 10645 Query: 425 ggggagcctggcgggctacagtccctagggt 455 |||||||||||| ||||||||||| |||||| Sbjct: 10644 ggggagcctggcaggctacagtccatagggt 10614 Score = 89.7 bits (45), Expect = 2e-15 Identities = 81/93 (87%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||| ||||||||||| || |||| |||||| | ||||||| |||||||||||| Sbjct: 77883 taaagaatccgcctgcaatgcaagagaccctggttcaattcctgggttgggaagatcccc 77824 Query: 369 cggagaagggaatggctacccactccagtattc 401 |||||||||| || ||||||||||||||||| Sbjct: 77823 tggagaagggataggttacccactccagtattc 77791 Score = 83.8 bits (42), Expect = 9e-14 Identities = 117/142 (82%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||||||| |||| ||| ||| ||| | ||| || |||||| ||||||| || Sbjct: 87432 ggtaaagaatctgcttgcagtgcgggagacctgagtttgatctctgggtcgggaagaccc 87491 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||| ||| ||||| |||||||||||||||| |||| |||||| ||| |||||| Sbjct: 87492 cctggaaaagaagatggcaacccactccagtattctggcctggagaatcccatggacaga 87551 Query: 427 ggagcctggcgggctacagtcc 448 |||||||||||||||| ||||| Sbjct: 87552 ggagcctggcgggctatagtcc 87573 Score = 83.8 bits (42), Expect = 9e-14 Identities = 99/118 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| ||| |||| | ||||||| ||||||||| Sbjct: 97454 tggtaaagaatctgcctgcaatgcaggagaccttggtttgattcctgggttgggaagatc 97513 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||| |||||| |||||||||||||||| ||| |||| |||||| ||| |||| Sbjct: 97514 ccctggaaaagggataggctacccactccagttttctggcctggagaattccatggac 97571 Score = 81.8 bits (41), Expect = 4e-13 Identities = 92/109 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| | | |||| ||||| ||||||||||||| Sbjct: 55209 tggtaaagaatctgcctgcaatgcaggagatgcaggtttgatccctcggtggggaagatc 55150 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 || |||||| |||||||| ||||| | |||||||| ||||| |||||| Sbjct: 55149 tcctggagaaaggaatggccacccatttcagtattcttgcctggagaat 55101 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| |||| |||||| | ||||||| ||||||||| Sbjct: 35843 tggtaaagaatccacctgcaatgcaggagaccctggttcaattcctgggtcgggaagatc 35902 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||| ||||| ||||||||| |||||||||| Sbjct: 35903 ccctggaaaaggggtaggctacccaatccagtattc 35938 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| |||| ||| ||||||||| ||||| ||| Sbjct: 3825 tggtaaagaatctgcctgcaatgcaggagaccccagtttgatccctgggtcgggaatatc 3884 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | ||||||| || |||||||||||||||||||| Sbjct: 3885 ctctggagaagtgataggctacccactccagtattc 3920 Score = 75.8 bits (38), Expect = 2e-11 Identities = 98/118 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||| ||| ||||| ||| ||| || || ||||||||| ||||||||| Sbjct: 91107 tggtaaagaatctacctacaatgtgggagacctggctttgatccctgggttgggaagatc 91166 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || |||||||||| ||||||||||||||||||| ||||||||||| ||| |||| Sbjct: 91167 tcctggagaagggacaagctacccactccagtattctggcctagagaattccatggac 91224 Score = 75.8 bits (38), Expect = 2e-11 Identities = 98/118 (83%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||| || |||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 77767 tggtaaagattcggcctgcaatgtgggagacctgggttcgatccctgggttgggaagatc 77708 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||| | || || ||||||||||||||||| |||| |||||| ||| |||| Sbjct: 77707 ccctggagagagaaaaggttacccactccagtattctggcctggagaattccatggac 77650 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 28760 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 28819 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 28820 gcctggtgggct 28831 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 |||||||| ||||||||||| || ||| |||||||||||||||| ||||| | ||| Sbjct: 96607 ggaagatctcccggagaaggaaagggcaacccactccagtattcttgcctgggaaatcag 96548 Query: 418 acggacaggggagcctggcgggctacagtcc 448 || ||||| |||||||||| ||||||||||| Sbjct: 96547 acagacagaggagcctggcaggctacagtcc 96517 Score = 67.9 bits (34), Expect = 6e-09 Identities = 61/70 (87%) Strand = Plus / Minus Query: 378 gaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcg 437 ||||||| ||||||||||| |||| ||||| |||||| ||| |||||| |||||||||| Sbjct: 8933 gaatggcaacccactccagcattcttgcctggagaatcccatggacagaggagcctggcc 8874 Query: 438 ggctacagtc 447 |||| ||||| Sbjct: 8873 ggctgcagtc 8864 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 44074 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 44015 Query: 430 gcctgg 435 |||||| Sbjct: 44014 gcctgg 44009 Score = 67.9 bits (34), Expect = 6e-09 Identities = 77/90 (85%), Gaps = 1/90 (1%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcat-gc 405 ||||||||| |||||||||||| |||||| | |||||| ||||| |||||||||| | || Sbjct: 3443 tccctgggttgggaagatcccctggagaaagaaatggcaacccattccagtattcttggc 3502 Query: 406 ctagagaataccacggacaggggagcctgg 435 || |||||| ||| |||||| | ||||||| Sbjct: 3503 ctggagaatcccatggacagagaagcctgg 3532 Score = 65.9 bits (33), Expect = 2e-08 Identities = 60/69 (86%) Strand = Plus / Plus Query: 373 gaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcc 432 ||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| |||||||| Sbjct: 41171 gaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacgggggagcc 41230 Query: 433 tggcgggct 441 ||| ||||| Sbjct: 41231 tggtgggct 41239 Score = 65.9 bits (33), Expect = 2e-08 Identities = 51/57 (89%) Strand = Plus / Plus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 |||||| |||||||||||||||| ||||| |||||| ||| |||||| ||||||||| Sbjct: 86416 aatggcaacccactccagtattcttgcctggagaatcccagggacagaggagcctgg 86472 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||| |||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 31301 ggagaaggaaatggcaacccattccagtgttcttgcctggagaatcccagggacggggga 31360 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 31361 gcctggtgggct 31372 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| |||| |||||| ||| |||| ||||| Sbjct: 9717 ggagaaggaaatggcaacccactccagtgttctcgcctggagaatcccagggacggggga 9658 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 9657 gcctggtgggct 9646 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 74847 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccaaggatggggga 74906 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 74907 gcctggtgggct 74918 Score = 60.0 bits (30), Expect = 1e-06 Identities = 75/89 (84%), Gaps = 2/89 (2%) Strand = Plus / Plus Query: 312 agaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccgg 371 |||| ||||||||||||| ||| ||| ||||| |||||| ||| ||||||||| || Sbjct: 1859 agaacctgcctgcaatgcaggagacctgggtttgatccctg--tggcaaagatcccctgg 1916 Query: 372 agaagggaatggctacccactccagtatt 400 |||| |||||||||| ||||||||||||| Sbjct: 1917 agaacggaatggctatccactccagtatt 1945 Score = 60.0 bits (30), Expect = 1e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 |||||| ||||||||| ||||||||||| ||||| || |||||| |||||||||||| Sbjct: 33397 ggttcaatccctgggtcaggaagatcccctggagagggaaatggcaacccactccagt 33340 Score = 60.0 bits (30), Expect = 1e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcct 407 |||||||||||||||||||||||||||| ||| ||||| Sbjct: 85092 ggagaagggaatggctacccactccagtgttcttgcct 85129 Score = 58.0 bits (29), Expect = 5e-06 Identities = 62/73 (84%) Strand = Plus / Minus Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||| |||||| ||||||||||| ||| ||||| |||||| || |||| |||| Sbjct: 82905 cggagaaggcaatggcagcccactccagtgttcttgcctggagaatcccggggacggggg 82846 Query: 429 agcctggcgggct 441 ||||||| ||||| Sbjct: 82845 agcctggtgggct 82833 Score = 58.0 bits (29), Expect = 5e-06 Identities = 74/89 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||| |||||||||||| ||| | | |||||| || |||| | ||||| || Sbjct: 1240 tggtaaagaagttgcctgcaatgcgggagagctgggttctatctctggattgggaaaatt 1299 Query: 366 ccccggagaagggaatggctacccactcc 394 ||| ||||||||||| ||||||||||||| Sbjct: 1300 ccctggagaagggaaaggctacccactcc 1328 >gb|CM000188| Bos taurus chromosome 12-FRAG[11250000,11349999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 163/185 (88%), Gaps = 1/185 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||| |||||| |||| |||||||||||||||||||| Sbjct: 20155 ggtaaagaatctgcctgcaatgcaggagacccggattcaatccctgggtggggaagatcc 20214 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 | ||||||||||||||| |||||||||||||||| ||||| |||||| |||||||||| Sbjct: 20215 tctggagaagggaatggcaacccactccagtattcctgcctggagaatcccacggacaga 20274 Query: 427 ggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgactc 486 ||| ||||| |||||||||||| | |||| | ||||||| ||| || |||| ||||||| Sbjct: 20275 ggaacctggagggctacagtccgtggggtggcaaagagtcggacacgactg-agcgacta 20333 Query: 487 acact 491 ||||| Sbjct: 20334 acact 20338 Score = 89.7 bits (45), Expect = 2e-15 Identities = 120/145 (82%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| | ||||||| |||||||| ||| ||||||| |||||| |||||| ||||||| Sbjct: 8370 ggttcaattcctgggttgggaagattccctagagaaggaaatggcaacccaccccagtat 8311 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || ||||| | ||| | | |||||| ||||| |||||||||||||||| | |||| | | Sbjct: 8310 tcttgcctgggaaatcctatggacagaggagcttggcgggctacagtccatggggtcgca 8251 Query: 460 aagagttggatacaactgaagcgac 484 |||||||||| | ||||||| |||| Sbjct: 8250 aagagttggacataactgaaacgac 8226 Score = 89.7 bits (45), Expect = 2e-15 Identities = 69/77 (89%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| ||||||||||| |||||||||||||||||||| ||| Sbjct: 9759 tccctgggttgggaagatcccctggagaagggaaaggctacccactccagtattctggcc 9700 Query: 407 tagagaataccacggac 423 | |||||| ||| |||| Sbjct: 9699 tggagaatcccatggac 9683 Score = 79.8 bits (40), Expect = 1e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 346 gtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgc 405 |||||| ||| |||||||||||| ||||| ||||||||| ||||||||||||||| ||| Sbjct: 19545 gtccctaggttgggaagatcccctggagatgggaatggcagcccactccagtattcttgc 19486 Query: 406 ctagagaa 413 |||||||| Sbjct: 19485 ctagagaa 19478 Score = 75.8 bits (38), Expect = 2e-11 Identities = 68/78 (87%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| ||||||||||||||| ||| |||| |||||||||||||||| ||||||| Sbjct: 18093 atggtaaagcatctgcctgcaatgcaggagaccctggttcagtccctgggtcaggaagat 18034 Query: 365 cccccggagaagggaatg 382 ||| | |||||| |||| Sbjct: 18033 tccctgaagaaggaaatg 18016 >gb|CM000186| Bos taurus chromosome 10-FRAG[58320000,58419999] Length = 100000 Score = 184 bits (93), Expect = 3e-44 Identities = 144/161 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||| Sbjct: 32191 atggtaaagaatctgcctgcaatgcaggaaacctgggttcagtccctgggttgggaagat 32132 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | | |||||||||||||||||||||||||||||||| ||| | |||||| ||| ||||| Sbjct: 32131 tctctggagaagggaatggctacccactccagtattcttgcttggagaattccatggaca 32072 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||||||| ||||||||||| | ||||| ||||||| Sbjct: 32071 gaggagcctggcaggctacagtccatgaggttgcaaagagt 32031 Score = 147 bits (74), Expect = 8e-33 Identities = 140/162 (86%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||| ||||| ||| ||| |||| |||||||||||||||||||||| ||||| Sbjct: 89874 gtaaagaatctgtctgcattgcaggagacccaggttcagtccctgggtggggaacatccc 89815 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||| ||||||| |||||||||||||||| | ||| |||||| | | |||||| | Sbjct: 89814 ctggagaaaggaatggtaacccactccagtattcttacctggagaattctatggacagag 89755 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||| ||||||||||||||| | |||||| ||||| ||||| Sbjct: 89754 gagccaggcgggctacagtccatggggttgcaaagaattgga 89713 Score = 99.6 bits (50), Expect = 2e-18 Identities = 101/118 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||| | |||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 79189 tggtaaagaacccacctgcaatgcaggagacctgggttcgatccctgggttgggaagatc 79248 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| ||||||||||| |||||||| |||| |||||| ||| |||| Sbjct: 79249 ccctggagaagggaaaggctacccactgcagtattctggcctggagaattccatggac 79306 Score = 97.6 bits (49), Expect = 6e-18 Identities = 133/161 (82%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||||||||| ||| |||| |||| | ||||||| ||||||| Sbjct: 32413 atggtaaagaatctgcctgcaatgtgggagacccaggtttgatacctgggtcaggaagat 32354 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| ||||||||| ||||||||||||||| |||||| ||||| || ||| || ||||| Sbjct: 32353 tccctggagaaggggatggctacccactccggtattcttgcctggaaaatttcatggaca 32294 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | | || |||| |||||||||||| | |||| | ||||||| Sbjct: 32293 gagaagactggagggctacagtccatggggtcgcaaagagt 32253 Score = 83.8 bits (42), Expect = 9e-14 Identities = 79/90 (87%), Gaps = 1/90 (1%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatccccc-ggagaagggaatggctacccactccagtattcatgc 405 ||||||||| |||||||| |||| |||| |||| ||||| |||||||||||||||| ||| Sbjct: 23698 tccctgggtcgggaagattcccctggaggagggcatggcaacccactccagtattcttgc 23757 Query: 406 ctagagaataccacggacaggggagcctgg 435 || |||||| ||| |||||| ||||||||| Sbjct: 23758 ctggagaatcccatggacagaggagcctgg 23787 Score = 79.8 bits (40), Expect = 1e-12 Identities = 120/144 (83%), Gaps = 2/144 (1%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 |||| ||||| |||||||| ||||| |||||| | ||||||||||||||| ||||||| Sbjct: 13494 tggtgaagaacctgcctgccaatgcaggaaacatgcgttcagtccctgggtcaggaagat 13435 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| || || || ||||||||||||| ||||| || ||| ||| ||||| Sbjct: 13434 cccctggagaaggaaacagcaactcactccagtattcctgcct-gaaaattccatggaca 13376 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||||| ||| ||||||| Sbjct: 13375 gaagagcctggcaggccacagtcc 13352 Score = 79.8 bits (40), Expect = 1e-12 Identities = 76/88 (86%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||||||||| ||| ||| | |||| ||||||||| ||||||| Sbjct: 63602 atggtaaagaatctgcctgcaatgtgggagacctgcgttccatccctgggttaggaagat 63543 Query: 365 cccccggagaagggaatggctacccact 392 || | ||||||||||||| ||||||||| Sbjct: 63542 cctctggagaagggaatgactacccact 63515 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| |||| Sbjct: 78323 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacgaggga 78264 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||||| | ||||||| |||| |||||||||||| Sbjct: 78263 gcctggtgggctgccgtctatggggttgcacagagttgaatacgactgaagcgact 78208 Score = 77.8 bits (39), Expect = 6e-12 Identities = 84/99 (84%) Strand = Plus / Minus Query: 387 cccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagt 446 ||||||||||| ||| ||||| |||||| ||| |||||||||||||||| ||||| | || Sbjct: 72976 cccactccagtgttcttgcctggagaatcccagggacaggggagcctggtgggctgccgt 72917 Query: 447 ccctagggttgaaaagagttggatacaactgaagcgact 485 | || |||| | | ||||||||| || |||||||||||| Sbjct: 72916 ctctggggtcgcacagagttggacacgactgaagcgact 72878 Score = 77.8 bits (39), Expect = 6e-12 Identities = 99/119 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||| ||||| ||||||||||||| | |||||||||||||||| |||| Sbjct: 88991 tccctgggtcaggaagttcccctggagaagggaatgacaacccactccagtattcttgcc 88932 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | | ||| ||| |||||| ||| ||| | |||||| ||||| | |||||| ||||||| Sbjct: 88931 tgggaaatcccatggacagaggacccttgtgggctatagtccatggggttgcaaagagt 88873 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| ||| ||| ||||||||| ||||||||| ||||| || ||| || Sbjct: 20057 ggaagatcccctggaggaggaaatagctacccacaccagtattcttgcctggaaaatccc 19998 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| || ||||| |||||||||||| Sbjct: 19997 atggacagagggacctggtgggctacagtcc 19967 Score = 65.9 bits (33), Expect = 2e-08 Identities = 81/97 (83%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| | || |||| ||||| | |||||||||| ||| ||||| |||||| || Sbjct: 40792 ggaagatcccctgcaggagggcatggcaaaccactccagtgttcttgcctggagaatccc 40733 Query: 418 acggacaggggagcctggcgggctacagtccctaggg 454 | |||||| ||| |||||| |||| |||||| ||||| Sbjct: 40732 atggacagaggaacctggcaggctgcagtccataggg 40696 Score = 65.9 bits (33), Expect = 2e-08 Identities = 81/97 (83%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| | || |||| ||||| | |||||||||| ||| ||||| |||||| || Sbjct: 55510 ggaagatcccctgcaggagggcatggcaaaccactccagtgttcttgcctggagaatccc 55451 Query: 418 acggacaggggagcctggcgggctacagtccctaggg 454 | |||||| ||| |||||| |||| |||||| ||||| Sbjct: 55450 atggacagaggaacctggcaggctgcagtccataggg 55414 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| ||| |||||| ||||||||||| |||| ||||| |||||| ||| |||| ||||| Sbjct: 93628 ggaggaggaaatggcaacccactccagaattcttgcctggagaatcccagggacggggga 93687 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 93688 gcctggtgggct 93699 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||| | |||||| ||| |||| ||||| Sbjct: 23355 ggagaaggaaatggcaacccactccagtgttcttgcttggagaattccagggacggggga 23296 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 23295 gcctggtgggct 23284 Score = 63.9 bits (32), Expect = 9e-08 Identities = 63/72 (87%), Gaps = 1/72 (1%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 17909 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggac-gggga 17967 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 17968 gcctggtgggct 17979 Score = 63.9 bits (32), Expect = 9e-08 Identities = 95/116 (81%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| | ||| Sbjct: 25786 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggagga 25727 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| || |||| | ||||||||| || |||||||||||| Sbjct: 25726 gcctggtgggctgccgtctctggggtcacacagagttggacacgactgaagcgact 25671 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 14943 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 15002 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 15003 gcctggtgggct 15014 Score = 60.0 bits (30), Expect = 1e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 387 cccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagt 446 |||||||||||| || ||||| | ||| |||||||||| ||||||||| |||||||||| Sbjct: 78449 cccactccagtactcttgcctggcaaatcccacggacagaggagcctggggggctacagt 78390 Query: 447 cc 448 || Sbjct: 78389 cc 78388 Score = 58.0 bits (29), Expect = 5e-06 Identities = 71/85 (83%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||| ||||||| |||||| || ||| |||||||||||||||||| | ||| |||||| | Sbjct: 56563 gggatgatcccctggagaaaggcatgactacccactccagtattcttacctggagaattc 56504 Query: 417 cacggacaggggagcctggcgggct 441 || | || | ||||||||| ||||| Sbjct: 56503 catgaaccgaggagcctggtgggct 56479 Score = 58.0 bits (29), Expect = 5e-06 Identities = 71/85 (83%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||| ||||||| |||||| || ||| |||||||||||||||||| | ||| |||||| | Sbjct: 41837 gggatgatcccctggagaaaggcatgactacccactccagtattcttacctggagaattc 41778 Query: 417 cacggacaggggagcctggcgggct 441 || | || | ||||||||| ||||| Sbjct: 41777 catgaaccgaggagcctggtgggct 41753 >gb|CM000206| Bos taurus chromosome X-FRAG[42930000,43029999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 140/156 (89%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| || |||| |||||||||||||||| ||||||| Sbjct: 78522 atggtaaagaatctgcctgcaatgcgagagacccaggttcagtccctgggtcaggaagat 78581 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 78582 cccctggagaagggaatggctacccactccagtattcttgcctggagaattccatggaca 78641 Query: 425 ggggagcctggcgggctacagtccctagggttgaaa 460 | |||||||||| ||||||| ||| | ||||||||| Sbjct: 78642 gaggagcctggcaggctacattccgtggggttgaaa 78677 Score = 99.6 bits (50), Expect = 2e-18 Identities = 101/118 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||||| ||| || |||||| ||||||||| ||||||||| Sbjct: 49755 tggtaaagaatcggcctgcaatgcaggaggcctgggttcgatccctgggttgggaagatc 49814 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| |||||||||| | ||||||||||| |||||| |||| |||||| |||||||| Sbjct: 49815 cccaagagaagggaaagactacccactccggtattctggcctggagaattccacggac 49872 Score = 93.7 bits (47), Expect = 1e-16 Identities = 80/91 (87%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||| |||||||||| ||| |||||| |||||||||||||||| ||||| |||||| || Sbjct: 13387 ggaagttcccccggaggaggaaatggcaacccactccagtattcttgcctggagaattcc 13328 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | ||||| ||||||||| |||||||||||| Sbjct: 13327 atggacacaggagcctggtgggctacagtcc 13297 Score = 89.7 bits (45), Expect = 2e-15 Identities = 111/133 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| | |||||||||| |||| |||| ||||| || ||||||||||||| |||| Sbjct: 17081 tccctgggttgagaagatcccctggaggagggcatggcaactcactccagtattcttgcc 17140 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | || | ||| |||||| ||||||||| |||||||||||| | |||||| ||||||| Sbjct: 17141 tggaaatccccatggacagaggagcctggtgggctacagtccatggggttgcaaagagtc 17200 Query: 467 ggatacaactgaa 479 || ||||||||| Sbjct: 17201 agacacaactgaa 17213 Score = 83.8 bits (42), Expect = 9e-14 Identities = 93/110 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||||||||| ||| ||| || ||| |||||| || |||||||| Sbjct: 46095 atggtaaagaatctgcctgcaatgtgggagacctggattcgatccctgagttgggaagat 46154 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 | || ||||||| ||| ||||||||||||||||||| || || |||||| Sbjct: 46155 ctcctggagaagcgaacagctacccactccagtattcttgtctggagaat 46204 Score = 83.8 bits (42), Expect = 9e-14 Identities = 81/94 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| |||||||||||||||| ||| Sbjct: 33902 tccctgggttgggaagatcccctggaggagggcatggcaacccactccagtattctagcc 33961 Query: 407 tagagaataccacggacaggggagcctggcgggc 440 | |||||| ||| |||||| |||||||| |||| Sbjct: 33962 tggagaatcccatggacagaagagcctggtgggc 33995 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 21797 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 21738 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 21737 gcctggtgggct 21726 Score = 75.8 bits (38), Expect = 2e-11 Identities = 114/138 (82%), Gaps = 1/138 (0%) Strand = Plus / Plus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||| ||||||| ||| ||| || ||||||| ||||||| | |||||||||||| Sbjct: 83781 aaagaatccgcctgcagtgcaggagacgtgggttcaatccctggtttgggaagatcccct 83840 Query: 370 ggagaagggaatggcta-cccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||| | | | ||||||||||||||| ||||| |||||| |||||| || || Sbjct: 83841 ggagaagggcacatcaaccccactccagtattcttgcctggagaatcccacggggagagg 83900 Query: 429 agcctggcgggctacagt 446 |||||||| |||| |||| Sbjct: 83901 agcctggcaggctgcagt 83918 Score = 73.8 bits (37), Expect = 9e-11 Identities = 85/101 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| | |||||||||| ||||||| |||||| ||||||||||| ||| |||| Sbjct: 61287 tccctgggttgagaagatcccctagagaaggaaatggcaccccactccagtgttcttgcc 61346 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtc 447 | || ||| ||| |||||| ||||||||| |||||||||| Sbjct: 61347 tggaaaattccatggacagaggagcctggaaggctacagtc 61387 Score = 71.9 bits (36), Expect = 4e-10 Identities = 60/68 (88%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||| |||||| ||||||||| | ||| |||||||||||||||| |||| Sbjct: 67282 tccctgggttgggaaaatcccctggagaagggcaaggcaacccactccagtattcttgcc 67223 Query: 407 tagagaat 414 | |||||| Sbjct: 67222 tggagaat 67215 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 12604 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 12545 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 12544 gcctggtgggct 12533 Score = 69.9 bits (35), Expect = 1e-09 Identities = 87/103 (84%), Gaps = 1/103 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacc-cgggttcagtccctgggtggggaagat 364 ||||||||| |||||||||||||| ||| || | ||||||||||||| | |||||| Sbjct: 13128 tggtaaagagtctgcctgcaatgcaggagacaacaggttcagtccctgatctgtgaagat 13069 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcct 407 |||| |||||| | |||||| |||||||||||||||| ||||| Sbjct: 13068 cccctggagaatgaaatggcaacccactccagtattcttgcct 13026 Score = 63.9 bits (32), Expect = 9e-08 Identities = 50/56 (89%) Strand = Plus / Plus Query: 352 gggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||| |||||||||||| |||| ||| |||||| |||||||||||||||| ||||| Sbjct: 87140 gggtcgggaagatcccctggaggaggaaatggcaacccactccagtattcttgcct 87195 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||| | Sbjct: 49101 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggaa 49160 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 49161 gcctggtgggct 49172 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||| | ||| ||||| |||||| ||| |||| ||||| Sbjct: 65604 ggagaaggaaatggcaacccactccattgttcttgcctggagaatcccagggacggggga 65545 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 65544 gcctggtgggct 65533 Score = 61.9 bits (31), Expect = 3e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||| ||||||||||| |||||||| |||||| ||||| |||||||||| Sbjct: 11451 tccctgggtcaggaagatcccctggagaaggaaatggcaacccattccagtattc 11397 Score = 61.9 bits (31), Expect = 3e-07 Identities = 61/71 (85%) Strand = Plus / Plus Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| |||||| |||| ||||||| || ||||| |||||| ||| ||||||||||| Sbjct: 59951 gagaaggcaatggcaccccattccagtactcttgcctggagaatcccagggacaggggag 60010 Query: 431 cctggcgggct 441 ||||| ||||| Sbjct: 60011 cctggtgggct 60021 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||||| ||| Sbjct: 50279 ggagaaggaaatggcaacccactccagggttcttgcctggagaatcccagggacagagga 50220 Query: 430 gcctgg 435 |||||| Sbjct: 50219 gcctgg 50214 Score = 60.0 bits (30), Expect = 1e-06 Identities = 112/138 (81%), Gaps = 1/138 (0%) Strand = Plus / Plus Query: 311 aagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccg 370 |||||||||||| ||||| ||| |||| |||| |||||| || |||||||||||| | Sbjct: 78798 aagaatctgcctataatgcaggagacccaggtttgatccctgagttgggaagatcccctg 78857 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| |||| | | ||||||||||||| ||||| | ||| ||| |||||| |||| Sbjct: 78858 gagaaggaaatgac-agtcactccagtattcttgcctgggaaatcccatggacagaggag 78916 Query: 431 cctggcgggctacagtcc 448 | ||| |||||| ||||| Sbjct: 78917 catggtgggctatagtcc 78934 Score = 58.0 bits (29), Expect = 5e-06 Identities = 112/137 (81%), Gaps = 2/137 (1%) Strand = Plus / Plus Query: 313 gaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccgga 372 |||||||||||||| | ||| ||| | ||| | |||||| || |||||||||||| || Sbjct: 11621 gaatctgcctgcaacgtgggagacctgagtttaatccctgagttgggaagatcccctaga 11680 Query: 373 gaagggaatggctacccactccagtattcatgcctagagaat-accacggacaggggagc 431 | ||| |||| |||||||||||||||| ||||| |||||| ||| |||||| ||||| Sbjct: 11681 ggaggccttggcaacccactccagtattcttgcctggagaatccccatggacagaggagc 11740 Query: 432 ctggcgggctacagtcc 448 || |||||||| ||||| Sbjct: 11741 ct-gcgggctatagtcc 11756 Score = 58.0 bits (29), Expect = 5e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacc 337 ||||||||||||||||||||||||| ||||||| Sbjct: 72369 atggtaaagaatctgcctgcaatgcaggaaacc 72337 Score = 58.0 bits (29), Expect = 5e-06 Identities = 47/53 (88%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||| |||| ||||| | |||||||||| |||||||||||||||||||| Sbjct: 49679 cctgggtcgggatgatccactggagaagggataggctacccactccagtattc 49731 Score = 58.0 bits (29), Expect = 5e-06 Identities = 53/61 (86%) Strand = Plus / Plus Query: 363 atcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgga 422 |||||| ||||||||||| ||||| |||||||||||||| |||| |||||| ||| ||| Sbjct: 76493 atcccctggagaagggaacggctatccactccagtattctggcctggagaattccatgga 76552 Query: 423 c 423 | Sbjct: 76553 c 76553 >gb|CM000184| Bos taurus chromosome 8-FRAG[93870000,93969999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 146/164 (89%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||| |||||||||| ||| ||| ||||||| ||||||||| |||||||| Sbjct: 14985 atggtaaagaatccacctgcaatgcaggagacctgggttcaatccctgggttgggaagat 15044 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||| |||||||||| |||||||||||||| ||||| | |||| ||||||||| Sbjct: 15045 cccctggagaatggaatggctatccactccagtattcttgcctggtgaattccacggaca 15104 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgg 468 | |||||||||||||||||||||| | |||||| |||||||||| Sbjct: 15105 gaggagcctggcgggctacagtccatggggttgcaaagagttgg 15148 Score = 123 bits (62), Expect = 1e-25 Identities = 146/174 (83%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||| |||||||||| ||| |||| |||||| ||| |||||||| ||||| Sbjct: 24165 atggtaaagaatccacctgcaatgcaggagacccaggttcaatccttgggtgggaaagat 24106 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||||||||||| |||||||||| ||||| ||||| ||||| |||||| || ||||| Sbjct: 24105 cccccggagaacagaatggctacacactctgctattcttgcctggagaatttcatggaca 24046 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | |||||||| | ||||| ||||| |||||||| ||||| | ||| |||||||| Sbjct: 24045 gaggagcctgacaggctatagtccatagggttgcaaagactgggacacaactga 23992 Score = 105 bits (53), Expect = 3e-20 Identities = 95/109 (87%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||| ||||||||||||| ||| |||| |||||| |||||||||| |||||| Sbjct: 402 atggtaaagaagctgcctgcaatgcaggagacccaggttcaatccctgggtgaagaagat 343 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaa 413 |||| ||||||||| ||||| ||||| ||||||| || ||||| ||||| Sbjct: 342 cccctggagaagggcatggcaacccattccagtactcttgcctggagaa 294 Score = 95.6 bits (48), Expect = 2e-17 Identities = 87/100 (87%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| ||||||||| ||||| |||||||||||||||| ||| | Sbjct: 32318 cctgggttgggaagatcccctggagaagggcatggcaacccactccagtattcttgcttg 32377 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 ||||| ||| |||||| ||||||| || ||||||||||| Sbjct: 32378 cagaatcccatggacagaggagcctagcaggctacagtcc 32417 Score = 95.6 bits (48), Expect = 2e-17 Identities = 81/92 (88%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||| ||||| |||||||||||| ||||||||||||||||||| ||||| |||||| | Sbjct: 66999 gggaaggtcccctggagaagggaatagctacccactccagtattcctgcctggagaattc 66940 Query: 417 cacggacaggggagcctggcgggctacagtcc 448 || || ||| |||||||||| ||| ||||||| Sbjct: 66939 catgggcagaggagcctggcaggccacagtcc 66908 Score = 95.6 bits (48), Expect = 2e-17 Identities = 121/143 (84%), Gaps = 3/143 (2%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||||||||||||||| ||||| | ||||||| || |||||| |||||| | Sbjct: 35717 ggtaaagaatctgcctgcaatgtgggaaatctgggttcaatcactgggttgggaagt--c 35774 Query: 367 cccggagaagggaatgg-ctacccactccagtattcatgcctagagaataccacggacag 425 || ||| ||||||||| |||||||||||||||||| |||| |||||| || |||||| Sbjct: 35775 cctggaagagggaatgggctacccactccagtattctggcctggagaattccgtggacag 35834 Query: 426 gggagcctggcgggctacagtcc 448 |||||||||| ||||||||||| Sbjct: 35835 aggagcctggcaggctacagtcc 35857 Score = 95.6 bits (48), Expect = 2e-17 Identities = 81/92 (88%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||| |||||||| |||||||||| ||| |||| |||||| | ||||||| ||||||||| Sbjct: 35597 tggtcaagaatctacctgcaatgcaggagaccccggttcaattcctgggtagggaagatc 35656 Query: 366 ccccggagaagggaatggctacccactccagt 397 ||| |||||||||| |||||||||||||||| Sbjct: 35657 ccctggagaagggataggctacccactccagt 35688 Score = 89.7 bits (45), Expect = 2e-15 Identities = 94/109 (86%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat-ac 416 ||||||||||| |||||||| |||||| ||||||||||||||| ||||| |||||| | Sbjct: 70033 ggaagatcccctggagaaggaaatggcatcccactccagtattcctgcctggagaatccc 70092 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 || |||||| |||||||||| ||||| |||| |||||||| ||||||| Sbjct: 70093 catggacagaggagcctggcaggctatggtccatagggttgcaaagagt 70141 Score = 89.7 bits (45), Expect = 2e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| |||||||||| ||| ||| ||||||| ||||||||| |||||||||| Sbjct: 23638 ggtaaagaatccacctgcaatgcgggagacctgggttcaatccctgggttgggaagatcc 23579 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || ||||||| ||| ||||| | ||||||||| || |||| |||||| ||| |||| Sbjct: 23578 cctggagaagtgaaaggctaactactccagtagtctggcctggagaattccatggac 23522 Score = 87.7 bits (44), Expect = 6e-15 Identities = 83/96 (86%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||||| || ||| |||| ||||| | ||||||| || |||||| Sbjct: 23758 tggtaaagaatctgcctgcaaagcaggagaccccagttcaattcctgggttggaaagatc 23699 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | |||||||||| |||||||||||||||||||| Sbjct: 23698 cacaggagaagggacaggctacccactccagtattc 23663 Score = 87.7 bits (44), Expect = 6e-15 Identities = 80/92 (86%) Strand = Plus / Plus Query: 388 ccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtc 447 |||||||||||||| ||||| |||||| ||| |||||| ||||| ||| ||||||||||| Sbjct: 13153 ccactccagtattcttgcctggagaatcccatggacagaggagcttggtgggctacagtc 13212 Query: 448 cctagggttgaaaagagttggatacaactgaa 479 | | ||||||||||| |||||| || |||||| Sbjct: 13213 catggggttgaaaagtgttggacacgactgaa 13244 Score = 85.7 bits (43), Expect = 2e-14 Identities = 103/123 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| | ||||||||||||| ||||||||||||| | |||| Sbjct: 65029 tccctgggtcaggaagatcccctgaagaagggaatggcaacccactccagtaattttgcc 64970 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| ||| | ||||||||||| |||| | | || | |||||||| Sbjct: 64969 tggagaatcccatggacagaggaacttggcgggctactgtccatggtgtcgcaaagagtt 64910 Query: 467 gga 469 ||| Sbjct: 64909 gga 64907 Score = 83.8 bits (42), Expect = 9e-14 Identities = 141/174 (81%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| ||| ||| |||||| ||| || |||||||| ||||||||| ||| ||| Sbjct: 11769 atggtaaagcgtctacctacaatgcgggagactcgggttcaatccctgggttaggaggat 11710 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 || | || ||||| |||||| ||||| ||||||| || ||||| || ||| ||| ||||| Sbjct: 11709 cctctggggaaggaaatggcaacccattccagtactcttgcctggaaaatcccatggaca 11650 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | ||||| ||| ||||||||||| | |||||| ||||||| ||| || ||||| Sbjct: 11649 gaggagcgtggtaggctacagtccatggggttgcaaagagtcggacacgactga 11596 Score = 77.8 bits (39), Expect = 6e-12 Identities = 115/139 (82%), Gaps = 1/139 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||| ||| |||||||| ||| | ||| |||| |||||| |||| Sbjct: 5262 tccctgggtcgggaagatgccctggagaaggaaatcacaacc-actctggtattcttgcc 5320 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| ||||||||| |||||| ||||| |||||| | ||||||| Sbjct: 5321 tggagaatcccatggacagaggagcctggtgggctatagtccatagggtcgcaaagagtc 5380 Query: 467 ggatacaactgaagcgact 485 |||| |||||||||||| Sbjct: 5381 agatatgactgaagcgact 5399 Score = 75.8 bits (38), Expect = 2e-11 Identities = 101/122 (82%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| |||| ||||| ||||||||||| |||| ||||| |||||| | Sbjct: 45216 ggaagatcccctggaggagggcatggcaacccactccagaattcttgcctggagaatcct 45275 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactg 477 |||||| ||||||| || |||| ||||| |||||| ||||||||||| ||||||| Sbjct: 45276 gtggacagaggagcctagcaggctgtagtccatagggtcacaaagagttggacacaactg 45335 Query: 478 aa 479 || Sbjct: 45336 aa 45337 Score = 71.9 bits (36), Expect = 4e-10 Identities = 66/76 (86%) Strand = Plus / Minus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| |||||||||||| ||||||| ||| || |||||||||||||||| |||| Sbjct: 45858 ccctgggttgggaagatcccctggagaagcgaaaagccacccactccagtattctggcct 45799 Query: 408 agagaataccacggac 423 ||||||| ||| |||| Sbjct: 45798 agagaattccatggac 45783 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||| | Sbjct: 72509 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggaa 72450 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 72449 gcctggtgggct 72438 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||||| || ||||| |||||| ||| |||||| ||| Sbjct: 59037 ggagaaggaaatggcaacccactccagtactcttgcctggagaatcccagggacagagga 59096 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 59097 gcctggtgggct 59108 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| |||| ||||| |||||||||||||| | ||||| | ||| || Sbjct: 16506 ggaagatcccctggaggagggcatggcaacccactccagtatccttgcctgggaaattcc 16447 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| ||||||||| | |||||||||| Sbjct: 16446 atggacagaggagcctggagtgctacagtcc 16416 Score = 67.9 bits (34), Expect = 6e-09 Identities = 52/58 (89%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||||||| ||||||||||| || ||||||||||||||||| |||| |||||| Sbjct: 13767 gggaagatcccctggagaagggaaaggttacccactccagtattctggcctggagaat 13824 Score = 65.9 bits (33), Expect = 2e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 48423 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 48364 Query: 430 gcctg 434 ||||| Sbjct: 48363 gcctg 48359 Score = 65.9 bits (33), Expect = 2e-08 Identities = 57/65 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||| | |||||| ||| |||||| ||| Sbjct: 16825 ggagaaggaaatggcaacccactccagtattcttgcttggagaatcccagggacagagga 16884 Query: 430 gcctg 434 ||||| Sbjct: 16885 gcctg 16889 >gb|CM000183| Bos taurus chromosome 7-FRAG[60840000,60939999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 131/144 (90%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| |||||||| |||||| |||||||| |||||||| Sbjct: 32907 atggtaaagaatctgcctgcaatgcaggaaacccaggttcaacccctgggttgggaagat 32966 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||| ||| |||||||||||| ||| ||||| Sbjct: 32967 cccctggagaagggaatggctacccactccagtgttcttgcctagagaatcccatggaca 33026 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||| ||||| ||||| Sbjct: 33027 gaggagcctggcaggctatagtcc 33050 Score = 101 bits (51), Expect = 4e-19 Identities = 117/139 (84%) Strand = Plus / Plus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||| |||||||||| ||| ||| ||||| ||||||||| | |||||||||| Sbjct: 35048 aaagaatccacctgcaatgcaggagacctgggtttgatccctgggttgtgaagatcccct 35107 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||||||| |||||||| |||||||||| | ||| |||||| ||| |||||| ||| Sbjct: 35108 ggagaagggaacagctacccattccagtattcttacctggagaattccatggacagagga 35167 Query: 430 gcctggcgggctacagtcc 448 ||||| | ||||||||||| Sbjct: 35168 gcctgacaggctacagtcc 35186 Score = 99.6 bits (50), Expect = 2e-18 Identities = 92/106 (86%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||| ||||||||||||||| ||| |||| ||||| ||||||||| |||||| ||||| Sbjct: 98749 taaagcatctgcctgcaatgcgggagacccaggttcgatccctgggttgggaaggtcccc 98690 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||| |||||| |||||||||||| ||| ||||| |||||| Sbjct: 98689 tggagaaggaaatggcaacccactccagtgttcttgcctggagaat 98644 Score = 89.7 bits (45), Expect = 2e-15 Identities = 121/145 (83%), Gaps = 1/145 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||| |||| ||| || ||| |||| | | ||||||||||||| || Sbjct: 52352 atggtaaagaatctgcatgcagtgcaggtaacgtgggtgcgattcctgggtggggaatat 52411 Query: 365 cccccggagaagggaatggctacccactc-cagtattcatgcctagagaataccacggac 423 |||| |||||||| |||||||||| |||| |||||| ||||| |||||| ||| ||| Sbjct: 52412 cccctggagaaggaaatggctacctactctgggtattcttgcctggagaattccatggat 52471 Query: 424 aggggagcctggcgggctacagtcc 448 || |||||||||||||||| ||||| Sbjct: 52472 agaggagcctggcgggctatagtcc 52496 Score = 89.7 bits (45), Expect = 2e-15 Identities = 117/141 (82%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||| |||| |||| ||| |||| || || | ||||||| ||||||||||| Sbjct: 39162 gtaaagaatctgtctgccatgcaggagaccctggctcgattcctgggtagggaagatccc 39103 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| | |||||||||||||| ||||| || ||| ||| ||||| | Sbjct: 39102 ctggagaaggaaatggcaatccactccagtattcttgcctggaaaatcccatggacaaag 39043 Query: 428 gagcctggcgggctacagtcc 448 || |||||| ||||| ||||| Sbjct: 39042 gaacctggcaggctatagtcc 39022 Score = 83.8 bits (42), Expect = 9e-14 Identities = 105/126 (83%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 ||||||||| |||||| |||| |||||| |||||||| |||||| ||| |||||||||| Sbjct: 84298 ggttcagtctctgggttgggatgatcccttggagaaggaaatggcaacctactccagtat 84239 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || ||||| | ||| ||| ||||||||||||||| |||||| ||||| |||||| | Sbjct: 84238 tcttgcctgggaaattccatggacaggggagcctgaagggctatagtccacggggttgca 84179 Query: 460 aagagt 465 |||||| Sbjct: 84178 aagagt 84173 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 59114 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 59173 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 59174 gcctggtgggct 59185 Score = 69.9 bits (35), Expect = 1e-09 Identities = 78/91 (85%), Gaps = 1/91 (1%) Strand = Plus / Minus Query: 358 ggaagatccccc-ggagaagggaatggctacccactccagtattcatgcctagagaatac 416 ||||||||||| |||| ||| |||||| |||||||||||||||| ||||| |||||| | Sbjct: 85248 ggaagatccccttggaggaggaaatggcaacccactccagtattcttgcctggagaatcc 85189 Query: 417 cacggacaggggagcctggcgggctacagtc 447 || |||||| | ||||||||| |||| |||| Sbjct: 85188 catggacagagaagcctggcgagctatagtc 85158 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 88620 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 88561 Query: 430 gcctgg 435 |||||| Sbjct: 88560 gcctgg 88555 Score = 63.9 bits (32), Expect = 9e-08 Identities = 95/116 (81%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||| | |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 89314 ggagaaggaaatgacaacccactccagtgttcttgcctggagaatcccagggacggggga 89373 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 ||||| ||||| | ||| | |||| | | ||||||||| |||||||||| |||| Sbjct: 89374 gcctgatgggctgccgtctatggggtcgcacagagttggacacaactgaagtgact 89429 Score = 63.9 bits (32), Expect = 9e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||| ||||| | |||| ||||||||||| ||||||||||||||||||| ||| Sbjct: 62670 tccctgggctgggaaaaacccctggagaagggaaaggctacccactccagtattttggcc 62611 Query: 407 tagagaat 414 |||||||| Sbjct: 62610 tagagaat 62603 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||| |||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 26146 ggagaaggaaatggcaacccattccagtgttcttgcctggagaatcccagggacggggga 26205 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 26206 gcctggtgggct 26217 Score = 61.9 bits (31), Expect = 3e-07 Identities = 88/107 (82%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||| ||| ||| ||| |||||| ||| ||||| |||||||||| Sbjct: 14842 gtaaagaatctgcctgtaatatgggagacctgggttctatccttgggtttggaagatccc 14901 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat 414 | |||||| |||| | ||||||| |||||||||| |||| |||||| Sbjct: 14902 ctggagaatggaaagactacccattccagtattctggcctggagaat 14948 Score = 61.9 bits (31), Expect = 3e-07 Identities = 76/91 (83%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||| | |||| ||||||||||||||| | ||| || ||| || Sbjct: 58686 ggaagatcccctggagaaggaactggcaacccactccagtatttttacctggaaaattcc 58745 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | | |||| ||| ||||| |||||||||||| Sbjct: 58746 atgaacagaggaacctggtgggctacagtcc 58776 Score = 58.0 bits (29), Expect = 5e-06 Identities = 83/101 (82%) Strand = Plus / Plus Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||| |||| | |||||||||||| || ||||| || ||| ||| |||||| || Sbjct: 43584 cggagaaggcaatgacaccccactccagtactcttgcctggaaaatcccatggacagagg 43643 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||| ||||| |||||| | |||| | | ||||||||| Sbjct: 43644 agcctggtgggctgcagtccatggggtcgcacagagttgga 43684 Score = 58.0 bits (29), Expect = 5e-06 Identities = 89/109 (81%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| || ||||| || ||| ||| |||| | ||| Sbjct: 58971 ggagaaggcaatggcaccccactccagtactcttgcctggaaaatcccatggacggagga 59030 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||| |||| |||||| |||||| |||||||||| |||||||| Sbjct: 59031 gcctggtaggctgcagtccacggggttgctaagagttggacacaactga 59079 >gb|CM000183| Bos taurus chromosome 7-FRAG[58230000,58329999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 131/144 (90%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| |||||||| |||||| |||||||| |||||||| Sbjct: 39156 atggtaaagaatctgcctgcaatgcaggaaacccaggttcaacccctgggttgggaagat 39215 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||| ||| |||||||||||| ||| ||||| Sbjct: 39216 cccctggagaagggaatggctacccactccagtgttcttgcctagagaatcccatggaca 39275 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||| ||||| ||||| Sbjct: 39276 gaggagcctggcaggctatagtcc 39299 Score = 101 bits (51), Expect = 4e-19 Identities = 117/139 (84%) Strand = Plus / Plus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||| |||||||||| ||| ||| ||||| ||||||||| | |||||||||| Sbjct: 41297 aaagaatccacctgcaatgcaggagacctgggtttgatccctgggttgtgaagatcccct 41356 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||||||| |||||||| |||||||||| | ||| |||||| ||| |||||| ||| Sbjct: 41357 ggagaagggaacagctacccattccagtattcttacctggagaattccatggacagagga 41416 Query: 430 gcctggcgggctacagtcc 448 ||||| | ||||||||||| Sbjct: 41417 gcctgacaggctacagtcc 41435 Score = 95.6 bits (48), Expect = 2e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 315 atctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggaga 374 ||||| || |||||| ||| |||||||||| |||||||||| |||||||||| | ||||| Sbjct: 66261 atctgtctacaatgcgggagacccgggttcggtccctgggtcgggaagatccgctggaga 66202 Query: 375 agggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctg 434 ||| |||||| | ||||||||||| | ||||| || ||| ||| |||||| |||||||| Sbjct: 66201 aggaaatggcaatccactccagtactattgcctggaaaatgccatggacagaggagcctg 66142 Query: 435 gcgggctacagtccctagggttgaaaagagttggatacaactga 478 | |||||||| || | ||| | ||||||||||| || ||||| Sbjct: 66141 gtaggctacagcccatgaggtcgcaaagagttggacacgactga 66098 Score = 89.7 bits (45), Expect = 2e-15 Identities = 117/141 (82%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||| |||| |||| ||| |||| || || | ||||||| ||||||||||| Sbjct: 45413 gtaaagaatctgtctgccatgcaggagaccctggctcgattcctgggtagggaagatccc 45354 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| | |||||||||||||| ||||| || ||| ||| ||||| | Sbjct: 45353 ctggagaaggaaatggcaatccactccagtattcttgcctggaaaatcccatggacaaag 45294 Query: 428 gagcctggcgggctacagtcc 448 || |||||| ||||| ||||| Sbjct: 45293 gaacctggcaggctatagtcc 45273 Score = 75.8 bits (38), Expect = 2e-11 Identities = 98/118 (83%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||| ||||||||||| | ||| ||| |||||| ||||||||| ||||||||| Sbjct: 65781 tggtaaaaaatctgcctgccccgagggagacctgggttccatccctgggttgggaagatc 65722 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||| | |||||||||||||| ||||| |||| |||||| ||| |||| Sbjct: 65721 ccctggagaagggtaaggctacccactccaatattctggcctggagaattccatggac 65664 Score = 73.8 bits (37), Expect = 9e-11 Identities = 92/109 (84%), Gaps = 1/109 (0%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | |||||| ||||| ||||||||||||||||||||||| |||| ||| |||| Sbjct: 62098 tccctggatagggaag-tcccctggagaagggaatggctacccactgcagtcttcttgcc 62040 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 | | || | | |||||| ||||||||| |||||||||||| |||||| Sbjct: 62039 tgggaaacccaaaggacagaggagcctggtgggctacagtccatagggt 61991 Score = 73.8 bits (37), Expect = 9e-11 Identities = 77/89 (86%), Gaps = 1/89 (1%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatccc-ccggagaagggaatggctacccactccagtattcatgc 405 ||||||||| ||||||||||| |||||||||| |||||| |||||||||||||| | || Sbjct: 17828 tccctgggtcgggaagatcccgccggagaaggaaatggcaacccactccagtatcctcgc 17769 Query: 406 ctagagaataccacggacaggggagcctg 434 || | ||| |||||||||| |||||||| Sbjct: 17768 ctgggaaatgccacggacagaggagcctg 17740 Score = 73.8 bits (37), Expect = 9e-11 Identities = 77/89 (86%), Gaps = 1/89 (1%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatccc-ccggagaagggaatggctacccactccagtattcatgc 405 ||||||||| ||||||||||| |||||||||| |||||| |||||||||||||| | || Sbjct: 21369 tccctgggtcgggaagatcccgccggagaaggaaatggcaacccactccagtatcctcgc 21310 Query: 406 ctagagaataccacggacaggggagcctg 434 || | ||| |||||||||| |||||||| Sbjct: 21309 ctgggaaatgccacggacagaggagcctg 21281 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 71016 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 71075 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 71076 gcctggtgggct 71087 Score = 67.9 bits (34), Expect = 6e-09 Identities = 52/58 (89%) Strand = Plus / Minus Query: 391 ctccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||||||||| ||| |||||||| ||| |||||| ||||||||| |||||||||||| Sbjct: 55487 ctccagtattcttgcatagagaatcccatggacagaggagcctggtgggctacagtcc 55430 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| | |||| ||| |||| ||||| Sbjct: 61592 ggagaaggaaatggcaacccactccagtgttcttgcctggcgaatcccagggacggggga 61533 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 61532 gcctggtgggct 61521 Score = 60.0 bits (30), Expect = 1e-06 Identities = 77/90 (85%), Gaps = 2/90 (2%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatccc-ccggagaagggaatggctacccact-ccagtattcatg 404 ||||||||| ||||||||||| |||||||||| |||||| ||||||| ||||||| | | Sbjct: 14287 tccctgggtcgggaagatccctccggagaaggaaatggcaacccactcccagtatcctcg 14228 Query: 405 cctagagaataccacggacaggggagcctg 434 ||| | ||| |||||||||| |||||||| Sbjct: 14227 cctgggaaatgccacggacagaggagcctg 14198 Score = 60.0 bits (30), Expect = 1e-06 Identities = 77/90 (85%), Gaps = 2/90 (2%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatccc-ccggagaagggaatggctacccact-ccagtattcatg 404 ||||||||| ||||||||||| |||||||||| |||||| ||||||| ||||||| | | Sbjct: 10738 tccctgggtcgggaagatcccgccggagaaggaaatggcaacccactcccagtatcctcg 10679 Query: 405 cctagagaataccacggacaggggagcctg 434 ||| | ||| |||||||||| |||||||| Sbjct: 10678 cctgggaaatgccacggacagaggagcctg 10649 Score = 58.0 bits (29), Expect = 5e-06 Identities = 45/49 (91%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatccc-ccggagaagggaatggctacccactcc 394 ||||||||| ||||||||||| |||||||||| |||||| ||||||||| Sbjct: 24900 tccctgggtcgggaagatcccgccggagaaggaaatggcaacccactcc 24852 Score = 58.0 bits (29), Expect = 5e-06 Identities = 71/85 (83%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||| ||| | |||||||||||| ||| ||||| | |||| || Sbjct: 76891 ggaagatcccctggagaaggacatgacaacccactccagtcttcttgcctggggaatccc 76950 Query: 418 acggacaggggagcctggcgggcta 442 | |||||| ||| ||||| |||||| Sbjct: 76951 atggacagaggaacctggtgggcta 76975 >gb|CM000202| Bos taurus chromosome 26-FRAG[34380000,34479999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 131/144 (90%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| ||||||||| |||| |||||| ||||||||| |||||||| Sbjct: 57531 atggtaaagaatctgcctgtaatgctggagacccaggttcaatccctgggtcgggaagat 57590 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| |||||||||| ||||| ||||| |||||| ||| ||||| Sbjct: 57591 cccctggagaagggaatggcaacccactccaatattcttgcctggagaatcccatggaca 57650 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||||||||||||||| Sbjct: 57651 gaggagcctggcgggctacagtcc 57674 Score = 131 bits (66), Expect = 4e-28 Identities = 123/142 (86%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||| | || | ||||||| |||||| ||||||||| |||||||||| Sbjct: 89092 ggtaaagaatctgcccgaaacacaggaaacctgggttcgatccctgggttgggaagatcc 89151 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||||| ||||||||| ||| |||||||||||| |||||||||||| ||| |||||| Sbjct: 89152 cctggagaggggaatggcaacctactccagtattcttgcctagagaattccatggacaga 89211 Query: 427 ggagcctggcgggctacagtcc 448 ||||||||| | |||||||||| Sbjct: 89212 ggagcctggtgagctacagtcc 89233 Score = 107 bits (54), Expect = 6e-21 Identities = 144/174 (82%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| |||||||||||| | ||| ||| ||||| ||||||||| |||||||| Sbjct: 46540 atggtaaagcgtctgcctgcaatacgggagacctaggttccatccctgggttgggaagat 46599 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || |||||||| |||||| ||||| |||||||||| ||||| |||||| ||| ||||| Sbjct: 46600 ctcctggagaaggaaatggcaacccattccagtattcctgcctggagaatcccagggaca 46659 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | ||||||||| || |||| ||| | |||| | ||||||||||| || ||||| Sbjct: 46660 gaggagcctggtaggttacaatccatggggtcgcaaagagttggacacgactga 46713 Score = 101 bits (51), Expect = 4e-19 Identities = 84/95 (88%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||| |||||| ||| ||| ||||||||||||||||| |||||||| Sbjct: 41228 atggtaaagaatctgccttcaatgcgggagacctgggttcagtccctgggttgggaagat 41169 Query: 365 cccccggagaagggaatggctacccactccagtat 399 |||| ||||| |||| |||||||||||||||| Sbjct: 41168 cccctggagagtggaacatctacccactccagtat 41134 Score = 99.6 bits (50), Expect = 2e-18 Identities = 106/123 (86%), Gaps = 5/123 (4%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgc--tggaaacccgggttcagtccctgggtggggaag 362 ||||||||||||||||||||||||| || |||| ||||| ||| || || || ||| Sbjct: 79552 atggtaaagaatctgcctgcaatgcactg---acccaggttcgatccttgagttggaaag 79496 Query: 363 atcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgga 422 |||||| |||||||||||||||||||||||||||||||| ||||| |||||| ||| ||| Sbjct: 79495 atcccctggagaagggaatggctacccactccagtattcttgcctggagaattccatgga 79436 Query: 423 cag 425 ||| Sbjct: 79435 cag 79433 Score = 99.6 bits (50), Expect = 2e-18 Identities = 95/110 (86%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||| || ||||||| |||||| | ||||||||||| Sbjct: 38111 gggttcaatccctgggtcaggaagatctcctagagaaggaaatggcaatccactccagta 38052 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| |||||||| ||||||||||| || |||||||||| ||||| ||||| Sbjct: 38051 ttcttgcctagaaaataccacggatagaggagcctggcaggctatagtcc 38002 Score = 93.7 bits (47), Expect = 1e-16 Identities = 71/79 (89%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||||||||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 52515 ggagaagggaatggcaacccactccagtattcttgcctggagaatcccatggacagagga 52456 Query: 430 gcctggcgggctacagtcc 448 ||| || |||||||||||| Sbjct: 52455 gccaggtgggctacagtcc 52437 Score = 93.7 bits (47), Expect = 1e-16 Identities = 104/123 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| | || ||| |||||| |||||||| | |||| ||||| |||||| || Sbjct: 72582 ggaagatcccctgcaggaggaaatggcaacccactctaatattgttgcctggagaatccc 72523 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactg 477 | |||||| ||||||||||||||||||| || |||||||| ||||| | ||| ||||||| Sbjct: 72522 agggacagaggagcctggcgggctacagcccatagggttgcaaagaatcggacacaactg 72463 Query: 478 aag 480 ||| Sbjct: 72462 aag 72460 Score = 91.7 bits (46), Expect = 4e-16 Identities = 107/126 (84%), Gaps = 1/126 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||| |||||||| ||| |||| |||||| |||||| || ||||||| Sbjct: 34445 atggtaaagaatctgcatgcaatgcaggagacccaggttcaatccctgagtcaggaagat 34386 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||| |||| |||| ||||||| ||||||||||| ||| ||||| Sbjct: 34385 -ccccatagaagggaatggttacctactctagtattcttgcctagagaactccatggaca 34327 Query: 425 ggggag 430 | |||| Sbjct: 34326 gaggag 34321 Score = 91.7 bits (46), Expect = 4e-16 Identities = 89/102 (87%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 ||||||||||||||||||||| |||||| ||| ||| ||||||||||||||||| | ||| Sbjct: 41836 ccctgggtggggaagatcccctggagaaaggagtggttacccactccagtattctttcct 41895 Query: 408 agagaataccacggacaggggag-cctggcgggctacagtcc 448 |||||| ||| |||||| |||| || ||| ||||||||||| Sbjct: 41896 ggagaattccatggacagaggagccccggcaggctacagtcc 41937 Score = 89.7 bits (45), Expect = 2e-15 Identities = 84/97 (86%) Strand = Plus / Minus Query: 352 gggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctagag 411 |||| ||||| |||||| ||||||||||||||| |||||||| ||||||| ||||| ||| Sbjct: 87576 gggtcgggaaaatcccctggagaagggaatggcaacccactcaagtattcttgcctggag 87517 Query: 412 aataccacggacaggggagcctggcgggctacagtcc 448 ||| ||||| ||| ||||||| | |||||||||||| Sbjct: 87516 aattacacgggcagaggagccttgtgggctacagtcc 87480 Score = 85.7 bits (43), Expect = 2e-14 Identities = 130/159 (81%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||| ||| ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 64190 ggtaaagaatctgcctgcagtgcaggagacctgggttcaatccctgggttaggaagatcc 64131 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||| |||| ||| | |||||||| ||||| ||||| |||||| ||| ||| || Sbjct: 64130 cctggaggagggcatgataatccactccaatattcttgcctggagaatcccatggataga 64071 Query: 427 ggagcctggcgggctacagtccctagggttgaaaagagt 465 |||| | |||||||||||| | |||||| ||||||| Sbjct: 64070 agagctctgtgggctacagtccgtggggttgcaaagagt 64032 Score = 81.8 bits (41), Expect = 4e-13 Identities = 105/125 (84%), Gaps = 1/125 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| ||| ||||| |||| |||||||||||| ||| | || Sbjct: 96703 tccctgggttgggaagatcccctggaagagggagtggcaacccactccagtgttcttccc 96762 Query: 407 tagagaataccacggacaggggagcctggcgggc-tacagtccctagggttgaaaagagt 465 | |||||| ||| |||||| ||| | |||||| | |||||||| | |||||| ||||||| Sbjct: 96763 tggagaatcccatggacagaggaacatggcggtcttacagtccatggggttgcaaagagt 96822 Query: 466 tggat 470 ||||| Sbjct: 96823 tggat 96827 Score = 77.8 bits (39), Expect = 6e-12 Identities = 84/99 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||| ||||||| |||| ||| ||||| |||||||||||||||| ||| Sbjct: 47757 tccctgggttgggatgatcccctggaggaggaaatggtaacccactccagtattctcgcc 47816 Query: 407 tagagaataccacggacaggggagcctggcgggctacag 445 |||| ||| ||| ||| || |||||||||| |||||||| Sbjct: 47817 tagaaaatcccatggagagaggagcctggcaggctacag 47855 Score = 77.8 bits (39), Expect = 6e-12 Identities = 78/91 (85%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||| |||||||| | ||| | ||||||||| |||| || | || ||||||||| Sbjct: 13869 taaagaatccacctgcaattcgggagatccgggttcaatccccggattggaaagatcccc 13810 Query: 369 cggagaagggaatggctacccactccagtat 399 ||||||||||| |||||||||||||||||| Sbjct: 13809 tggagaagggaaaggctacccactccagtat 13779 Score = 77.8 bits (39), Expect = 6e-12 Identities = 78/91 (85%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 |||||||| || ||| |||| |||||| |||||||||||||||| ||||||| ||| || Sbjct: 39153 ggaagatctcctggaaaaggaaatggcaacccactccagtattcttgcctaggaaatccc 39094 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| |||||||| |||||||||||| Sbjct: 39093 atggacagaggagcctgttgggctacagtcc 39063 Score = 77.8 bits (39), Expect = 6e-12 Identities = 75/87 (86%) Strand = Plus / Plus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||| | ||||||||||||||| |||| ||||||||||| ||||| |||||| || Sbjct: 82022 gaagatcctctggagaagggaatggcaacccgctccagtattcctgcctggagaatcccg 82081 Query: 419 cggacaggggagcctggcgggctacag 445 |||||| || |||||||| ||||||| Sbjct: 82082 tggacagaggggcctggcgagctacag 82108 Score = 75.8 bits (38), Expect = 2e-11 Identities = 98/118 (83%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| || |||||| ||||| | | ||||||||| Sbjct: 63562 tggtaaagaatccacctgcaatgcaggagacttgggttcgatccctcgcttgggaagatc 63621 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||| |||| ||||||||||| |||||||| ||||||||||| ||| |||| Sbjct: 63622 ccctagagaaaggaaaggctacccacttcagtattctggcctagagaattccatggac 63679 Score = 73.8 bits (37), Expect = 9e-11 Identities = 61/69 (88%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| |||||| || ||||||||||| |||||||| |||||| ||||||||||||| Sbjct: 45504 gggttcaatccctgagtcaggaagatcccctggagaaggaaatggcaacccactccagta 45445 Query: 399 ttcatgcct 407 ||| ||||| Sbjct: 45444 ttcttgcct 45436 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||| ||| ||| ||||| |||||| ||| |||||||||| Sbjct: 91474 ggagaaggaaatggcaacccactctagtgttcttgcctggagaatcccagggacagggga 91533 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 91534 gcctggtgggct 91545 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 75590 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 75649 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 75650 gcctggtgggct 75661 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||| ||| ||||||||| ||| ||| ||||||| ||| ||| | ||||| ||| Sbjct: 35767 tggtaaagtatccacctgcaatgtgggagacctgggttcaatccatggattgggaaaatc 35826 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||||| ||||||||||||||| |||| Sbjct: 35827 ccctggagaagggaaaggctacccactccagcattc 35862 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| | || ||||| | ||||||| ||||||||| Sbjct: 63443 tggtaaagaatccacctgcaatgcaggagagcccagttcaattcctgggttgggaagatc 63502 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | ||||||| || |||||||||||||||||||| Sbjct: 63503 cactggagaagagataggctacccactccagtattc 63538 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||| | |||| |||| ||||| |||||||| |||| || |||||||||||| || Sbjct: 28626 ggaagatcctctggaggagggcatggcaacccactctagtagtcttgcctagagaatccc 28567 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | | |||| |||||||| |||||||||||| Sbjct: 28566 atgcacagaggagcctgctgggctacagtcc 28536 Score = 65.9 bits (33), Expect = 2e-08 Identities = 91/109 (83%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || ||||||||| | |||| |||| ||||| ||||||||||||||| || | Sbjct: 6859 tccctgagttgggaagatctgctggaggagggcatggcatcccactccagtattcttgtc 6918 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 | |||||| ||| |||||| ||||||||| ||| |||||||| |||||| Sbjct: 6919 tggagaatcccatggacagaggagcctggtggg-tacagtccatagggt 6966 Score = 63.9 bits (32), Expect = 9e-08 Identities = 57/64 (89%), Gaps = 1/64 (1%) Strand = Plus / Plus Query: 386 acccactccagtattcatgcctagagaat-accacggacaggggagcctggcgggctaca 444 |||||||||||||||| ||||| |||||| ||| |||||| ||| |||||||||||||| Sbjct: 76014 acccactccagtattcttgcctggagaatccccaaggacagaggaacctggcgggctaca 76073 Query: 445 gtcc 448 |||| Sbjct: 76074 gtcc 76077 Score = 63.9 bits (32), Expect = 9e-08 Identities = 80/96 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| ||| |||||| |||||||||||||||| || || | ||| || |||||| ||| Sbjct: 95699 ggaggaggaaatggcaacccactccagtattcttgtctgggaaatctcatggacagagga 95640 Query: 430 gcctggcgggctacagtccctagggttgaaaagagt 465 |||||| |||||||||||| | |||||| ||||||| Sbjct: 95639 gcctggtgggctacagtccatggggttgcaaagagt 95604 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||| |||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 31179 ggagaaggaaatggcaacccactgcagtgttcttgcctggagaatcccagggacggggga 31238 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 31239 gcctggtgggct 31250 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| || || |||||| ||| |||| ||||| Sbjct: 46228 ggagaaggaaatggcaacccactccagtgttcttgtctggagaatcccagggacggggga 46287 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 46288 gcctggtgggct 46299 Score = 61.9 bits (31), Expect = 3e-07 Identities = 49/55 (89%) Strand = Plus / Minus Query: 360 aagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||| ||||||||| ||||| ||| |||||||||||| ||||| |||||| Sbjct: 68643 aagatcccctggagaagggtatggcaacctactccagtattcttgcctggagaat 68589 Score = 58.0 bits (29), Expect = 5e-06 Identities = 41/45 (91%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||| |||||| | |||||||||||||| |||||||||||| Sbjct: 71240 ggagaaggaaatggcaagccactccagtattcttgcctagagaat 71284 >gb|CM000201| Bos taurus chromosome 25-FRAG[16830000,16929999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 131/144 (90%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| |||||||||||||||| |||||||| Sbjct: 28948 atggtaaagaatctgcctgcaatgcaggagacctaggttcagtccctgggttgggaagat 29007 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||| ||||||| ||||| |||||| ||| ||||| Sbjct: 29008 cccctggagaagggaatggctacccactctagtattcctgcctggagaattccatggaca 29067 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||| ||||||||||| Sbjct: 29068 gaggagcctggcaggctacagtcc 29091 Score = 135 bits (68), Expect = 3e-29 Identities = 122/140 (87%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||| |||||||||||||| ||| ||| ||||| | | ||||||| |||||||||| Sbjct: 68295 gtaaagagtctgcctgcaatgcaggagacctgggtttaattcctgggtcaggaagatccc 68236 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| | Sbjct: 68235 ctggagaaggaaatggcaacccactccagtattcttgcctggagaatcccatggacagag 68176 Query: 428 gagcctggcgggctacagtc 447 ||||||||| |||||||||| Sbjct: 68175 gagcctggcaggctacagtc 68156 Score = 117 bits (59), Expect = 7e-24 Identities = 119/139 (85%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||| |||||||||||||| ||| ||| ||||| |||||||| ||||| |||| Sbjct: 44002 ggtaaagagtctgcctgcaatgcaggagacctgggtttgagccctgggtagggaatatcc 44061 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||||||||||| |||||||||||||||| || ||| | |||||| ||| |||||| Sbjct: 44062 cctggagaagggaatcgctacccactccagtagtcttgcttggagaattccatggacaga 44121 Query: 427 ggagcctggcgggctacag 445 |||||||||| |||||||| Sbjct: 44122 ggagcctggcaggctacag 44140 Score = 107 bits (54), Expect = 6e-21 Identities = 84/94 (89%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||| |||||||||| ||| ||| ||||||| ||||||||| ||||||||||| Sbjct: 22387 gtaaagaatccacctgcaatgcaggagacctgggttcaatccctgggttgggaagatccc 22446 Query: 368 ccggagaagggaatggctacccactccagtattc 401 | ||| ||||||||||||| |||||||||||||| Sbjct: 22447 ctggacaagggaatggctatccactccagtattc 22480 Score = 103 bits (52), Expect = 1e-19 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 315 atctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggaga 374 ||||||||||| ||| ||| ||| ||||||| || |||||| ||||||||||| ||||| Sbjct: 88803 atctgcctgcagtgcaggagacctgggttcaatcactgggtcaggaagatcccctggaga 88744 Query: 375 agggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctg 434 || |||||| ||| |||||||||| ||||| |||||| ||| |||||| |||||||| Sbjct: 88743 agaaaatggcaacctactccagtatgtttgcctggagaatcccatggacagaggagcctg 88684 Query: 435 gcgggctacagtccctagggttgaaaagagttggatacaactga 478 | |||||||||||| ||| || | ||||||||||| || ||||| Sbjct: 88683 g-gggctacagtccatagtgtggcaaagagttggacacgactga 88641 Score = 95.6 bits (48), Expect = 2e-17 Identities = 82/92 (89%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||||||| ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 53844 tggtaaagaatctgcctgcaatga-ggagacctgggttcaatccctgggttgggaagatc 53902 Query: 366 ccccggagaagggaatggctacccactccagt 397 ||| ||||||||||| | |||| ||||||||| Sbjct: 53903 ccctggagaagggaaagactactcactccagt 53934 Score = 93.7 bits (47), Expect = 1e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | || ||||||||| | |||||| |||||| ||| |||||||||||| |||| Sbjct: 50784 tccctggattggaaagatcccctgtagaaggaaatggcaacctactccagtattcttgcc 50843 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| ||| | |||| ||| ||||| |||||||||||| |||||||| ||||||| Sbjct: 50844 tggagaatcccatgaacagaggaacctggtgggctacagtccatagggttgcaaagagt 50902 Score = 93.7 bits (47), Expect = 1e-16 Identities = 101/119 (84%) Strand = Plus / Minus Query: 360 aagatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccac 419 ||||||||| |||| |||| ||||| |||||||||||||||| ||||| || ||| ||| Sbjct: 23017 aagatcccctggaggagggcatggcaacccactccagtattcttgcctggaaaatcccat 22958 Query: 420 ggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||| |||||||||| |||||| |||| |||||| ||||||||||| || ||||| Sbjct: 22957 ggacagaggagcctggcaggctacggtccatagggtcacaaagagttggacacgactga 22899 Score = 91.7 bits (46), Expect = 4e-16 Identities = 88/102 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||||||||||||||||| ||||||| |||||| | ||| ||||||| || |||| Sbjct: 75866 tccctgggtggggaagatccccccgagaaggaaatggcaagccaatccagtagtcttgcc 75925 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| |||||| ||||||||| |||||||||||| Sbjct: 75926 tgggaaatcccaaggacagaggagcctggtgggctacagtcc 75967 Score = 91.7 bits (46), Expect = 4e-16 Identities = 94/110 (85%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||| | |||||||||||| |||| |||| ||||| ||||||||||||| Sbjct: 65110 gggttcaatccctggattgggaagatcccctggaggagggcatggccacccactccagta 65051 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 || ||||| |||||| ||| |||||| ||||||||| | | |||||||| Sbjct: 65050 ttattgcctggagaatcccatggacagaggagcctggtgagttacagtcc 65001 Score = 89.7 bits (45), Expect = 2e-15 Identities = 103/121 (85%), Gaps = 1/121 (0%) Strand = Plus / Minus Query: 323 gcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaagggaatg 382 ||||||| ||| |||||||||| ||||||||| |||||||||||| |||||||| ||| Sbjct: 69113 gcaatgcgggagacccgggttcgatccctgggtcgggaagatcccctggagaaggacatg 69054 Query: 383 gcta-cccactccagtattcatgcctagagaataccacggacaggggagcctggcgggct 441 || | ||||||||||||||| ||||| |||||| ||| ||| | ||||||||| ||||| Sbjct: 69053 gcaaccccactccagtattcctgcctggagaatcccatggatggaggagcctggtgggct 68994 Query: 442 a 442 | Sbjct: 68993 a 68993 Score = 83.8 bits (42), Expect = 9e-14 Identities = 93/110 (84%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||| |||||||||||||| ||| ||| |||| | | || ||||||||||||| Sbjct: 49195 gggttcaatccttgggtggggaagattccctggaaaaggaattagcaacccactccagta 49136 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| |||| || ||| ||| |||||| ||||||||| |||||||||||| Sbjct: 49135 ttcttgcccaggaaatcccatggacagaggagcctggtgggctacagtcc 49086 Score = 83.8 bits (42), Expect = 9e-14 Identities = 132/162 (81%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||| | |||| ||||| | ||| |||| ||||| ||||||||| |||||||||| Sbjct: 76110 gtaaagagtatgcccgcaattcaggagacccaagttcaatccctgggtcaggaagatccc 76169 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| |||||||||||||||| ||||| || ||| ||| ||| | | Sbjct: 76170 ctggagaaggaaatggcaacccactccagtattcttgcctggaaaatcccatggatggag 76229 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||| |||||| ||||| | |||| | |||||| |||| Sbjct: 76230 gagcctgatgggctatagtccatggggtcgcaaagaggtgga 76271 Score = 81.8 bits (41), Expect = 4e-13 Identities = 107/129 (82%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||| ||||||| || | | ||||| |||| | ||||||| |||||||||| Sbjct: 13697 gtaaagaatctacctgcaacgcagaagacccgagttcgattcctgggtcaggaagatccc 13756 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| ||||| |||||||||| ||||| | ||| ||| |||||| | Sbjct: 13757 ctggagaaggaaatggcaacccattccagtattcttgcctggggaaacccatggacagag 13816 Query: 428 gagcctggc 436 ||||||||| Sbjct: 13817 gagcctggc 13825 Score = 81.8 bits (41), Expect = 4e-13 Identities = 85/97 (87%), Gaps = 2/97 (2%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaaccc-gggttcagtccctgggtggggaagat 364 |||||||||||||||||||||||| ||| |||| ||||| | | ||| ||| |||| | | Sbjct: 59324 tggtaaagaatctgcctgcaatgcaggagaccccgggttga-tgcctaggttgggatgtt 59382 Query: 365 cccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||||| |||||||||||||||||||| Sbjct: 59383 cccctggagaagggaaaggctacccactccagtattc 59419 Score = 77.8 bits (39), Expect = 6e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 387 cccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagt 446 |||||||||| |||| ||||| |||||| ||| |||||| |||||||||| ||||||||| Sbjct: 73202 cccactccagcattcttgcctggagaatcccatggacagaggagcctggcaggctacagt 73143 Query: 447 ccctagggttgaaaagagt 465 || | |||||| ||||||| Sbjct: 73142 ccatggggttgcaaagagt 73124 Score = 77.8 bits (39), Expect = 6e-12 Identities = 102/123 (82%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| | | ||| |||||| ||||| |||| ||||| |||| Sbjct: 51508 tccctgggttgggaagatcccctgaaacaggaaatggcaacccattccaatattcttgcc 51567 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | ||||| ||| |||||| ||||||||| ||||| |||||| | |||||| | |||||| Sbjct: 51568 tggagaactccatggacagaggagcctggtgggctccagtccatggggttgcagagagtt 51627 Query: 467 gga 469 ||| Sbjct: 51628 gga 51630 Score = 77.8 bits (39), Expect = 6e-12 Identities = 100/119 (84%), Gaps = 1/119 (0%) Strand = Plus / Plus Query: 330 tggaaacccgggttcagtccctgggtggggaagatccccc-ggagaagggaatggctacc 388 |||| ||| ||||||| || ||||| ||||||||||||| |||||||| | | |||| | Sbjct: 1253 tggagacctgggttcaacccttgggttgggaagatccccctggagaaggaagtagctatc 1312 Query: 389 cactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtc 447 ||||||||||||| | ||| ||||| ||| |||||| |||||||||| |||||||||| Sbjct: 1313 cactccagtattctttcctgaagaattccatggacagaggagcctggcaggctacagtc 1371 Score = 75.8 bits (38), Expect = 2e-11 Identities = 74/86 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||| |||||||| |||| | |||||||||||||||| |||| Sbjct: 14476 tccctgggtcaggaagatcccatggagaaggaaatgacaacccactccagtattcttgcc 14417 Query: 407 tagagaataccacggacaggggagcc 432 | |||||| ||| |||||| |||||| Sbjct: 14416 tggagaatcccatggacagaggagcc 14391 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 19 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 78 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 79 gcctggtgggct 90 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 84336 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 84395 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 84396 gcctggtgggct 84407 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 71907 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 71848 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 71847 gcctggtgggct 71836 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||| |||||||||||||| ||| |||| ||||| | ||||||| ||||||| | Sbjct: 96085 tggtaaagagtctgcctgcaatgcaggagaccctggttcgattcctgggtcgggaagagc 96144 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | |||||||||| ||||||| |||||||||||| Sbjct: 96145 ctttggagaagggataggctacctactccagtattc 96180 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| | |||||||| Sbjct: 63850 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccaggaacagggga 63791 Query: 430 gcctgg 435 |||||| Sbjct: 63790 gcctgg 63785 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| | || ||||| Sbjct: 77987 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccaggaacggggga 78046 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 78047 gcctggtgggct 78058 Score = 63.9 bits (32), Expect = 9e-08 Identities = 65/76 (85%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||| ||||| ||||| |||||| |||| |||| |||| ||||||||||||| Sbjct: 3256 gggttcaatccttgggttgggaaaatcccctggaggagggcatggtaacccactccagta 3315 Query: 399 ttcatgcctagagaat 414 ||| ||||| |||||| Sbjct: 3316 ttcttgcctggagaat 3331 Score = 63.9 bits (32), Expect = 9e-08 Identities = 83/100 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||||| || ||||| || || ||| |||||| ||| Sbjct: 65768 ggagaaggcaatggcaacccactccagtactcttgcctggaaaagcccatggacagagga 65709 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttgga 469 |||||| ||||| |||||| | |||| | |||||||||| Sbjct: 65708 gcctggtgggctgcagtccatggggtcgctaagagttgga 65669 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| | |||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 65625 ggagaaggaaatggcaagccactccagtgttcttgcctggagaatcccagggaccgggga 65566 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 65565 gcctggtgggct 65554 Score = 61.9 bits (31), Expect = 3e-07 Identities = 94/115 (81%) Strand = Plus / Plus Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||| || Sbjct: 89937 gagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggaag 89996 Query: 431 cctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 ||||| ||||| | ||| | |||||| | ||||| ||| || |||||||||||| Sbjct: 89997 cctggtgggctgccgtctatggggttgcacagagtcggacacgactgaagcgact 90051 Score = 61.9 bits (31), Expect = 3e-07 Identities = 100/121 (82%), Gaps = 4/121 (3%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| || ||||||| ||| || |||||| ||||||| | ||||||||| Sbjct: 96204 tggtaaagaatccgc-tgcaatgtgggaggcctgggttcgatccctggattgggaagatc 96262 Query: 366 ccccggagaag---ggaatggctacccactccagtattcatgcctagagaataccacgga 422 ||| ||||||| |||| |||||||||||||||||||| |||| |||||| ||| ||| Sbjct: 96263 ccctggagaagtttggaaaggctacccactccagtattctggcctggagaattccatgga 96322 Query: 423 c 423 | Sbjct: 96323 c 96323 Score = 58.0 bits (29), Expect = 5e-06 Identities = 54/61 (88%), Gaps = 1/61 (1%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||||||||||||||||| |||||||| |||| | ||||||| ||||| || |||| Sbjct: 17234 tccctgggtggggaagatcccctggagaaggaaatgac-acccacttcagtactcttgcc 17176 Query: 407 t 407 | Sbjct: 17175 t 17175 Score = 58.0 bits (29), Expect = 5e-06 Identities = 56/65 (86%) Strand = Plus / Plus Query: 391 ctccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtccct 450 |||||||| || ||||| |||||| ||| |||||| ||| |||||||| ||||||||||| Sbjct: 78803 ctccagtactcttgcctggagaattccagggacagaggaacctggcggactacagtccct 78862 Query: 451 agggt 455 |||| Sbjct: 78863 ggggt 78867 >gb|CM000200| Bos taurus chromosome 24-FRAG[3240000,3339999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 150/168 (89%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 303 gaatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaag 362 ||||||||||||||||||||||||||| ||| ||||||||||| ||||||||| | |||| Sbjct: 81717 gaatggtaaagaatctgcctgcaatgcaggagacccgggttcaatccctgggttgagaag 81658 Query: 363 atcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgga 422 |||||| ||||||||||||||| |||||||||||||||| ||||| |||||| ||| ||| Sbjct: 81657 atcccctggagaagggaatggcaacccactccagtattcttgcctggagaattccatgga 81598 Query: 423 caggggagcctggcgggctacagtccctagggttg-aaaagagttgga 469 ||| ||| ||||| |||||||||||| | |||||| |||||| ||||| Sbjct: 81597 cagaggaacctggtgggctacagtccatggggttgcaaaagatttgga 81550 Score = 117 bits (59), Expect = 7e-24 Identities = 146/175 (83%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||| | | ||||| ||| ||| ||||| ||||||||| ||||||| Sbjct: 92208 atggtaaagagtctgtcggtaatgcaggagacctgggtttgatccctgggtcaggaagat 92149 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||| |||||||| |||||||||| ||||| ||||| |||||| || ||||| Sbjct: 92148 cccctggagaaaggaatggcaacccactccaatattcttgcctggagaatttcatggaca 92089 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaa 479 | ||||||||||| |||||||||| | |||| ||||||||||| ||||||||| Sbjct: 92088 gaggagcctggcgagctacagtccatggggtcacaaagagttggacacaactgaa 92034 Score = 111 bits (56), Expect = 4e-22 Identities = 146/176 (82%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||| ||| ||| || | |||| ||||||||| |||||||| Sbjct: 61787 tggtaaagaatctgcctgtgctgcaggagacacaggttggatccctgggtcgggaagatg 61728 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||| |||| ||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 61727 ccctggaggagggcatggcgacccactccagtattcttgcctggagaatcccatggacag 61668 Query: 426 gggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagc 481 ||| ||||||||| |||||||| |||||| | | ||||| ||| || |||||||| Sbjct: 61667 aggaacctggcgggttacagtccatagggtcgcacagagtcggacacgactgaagc 61612 Score = 103 bits (52), Expect = 1e-19 Identities = 122/144 (84%), Gaps = 1/144 (0%) Strand = Plus / Plus Query: 304 aatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaaga 363 |||||||||||||||||||||| ||| ||| ||| ||||||| ||| ||||| | ||||| Sbjct: 5771 aatggtaaagaatctgcctgcagtgcaggagacctgggttcaatcc-tgggttgagaaga 5829 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 | || |||||||||||| | |||||||||||||||| ||||| | ||| ||| |||| Sbjct: 5830 tgccttggagaagggaataccaacccactccagtattcttgcctgggaaatcccatggac 5889 Query: 424 aggggagcctggcgggctacagtc 447 || | ||||||||||||||||||| Sbjct: 5890 agagaagcctggcgggctacagtc 5913 Score = 99.6 bits (50), Expect = 2e-18 Identities = 101/118 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||| || ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 14073 tggtaaagaatccacctgcagtgtgggagacctgggttcaatccctgggttgggaagatc 14132 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || ||| |||||||||||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 14133 tccaggaaaagggaatggctacccactccagtattctggcctggagaattccatggac 14190 Score = 99.6 bits (50), Expect = 2e-18 Identities = 95/110 (86%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| | |||||||||| |||| |||| ||||| ||||||||||||| Sbjct: 31127 gggttcaatccctgggtcgagaagatcccctggaggagggcatggcaacccactccagta 31068 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||||| || ||| ||| |||||| ||||||||| |||||||||||| Sbjct: 31067 tccttgcctggaaaatcccatggacagaggagcctggagggctacagtcc 31018 Score = 93.7 bits (47), Expect = 1e-16 Identities = 92/107 (85%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||||||||||||| ||||||||||| |||||||| ||||||||| |||||||||||| Sbjct: 71060 gttcagtccctgggttgggaagatcccttggagaaggaaatggctactcactccagtatt 71119 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtc 447 | ||||| || ||| || |||||| |||||||| ||| ||||||| Sbjct: 71120 cttgcctggaaaatttcatggacagaagagcctggtgggttacagtc 71166 Score = 87.7 bits (44), Expect = 6e-15 Identities = 83/96 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||| || ||||||| ||| ||| ||||| ||||||||| | |||||| Sbjct: 68252 tggtaaagaatctaccagcaatgcgggagacctgggtttgatccctgggttgcgaagatt 68311 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||||| |||||||||||||||||||| Sbjct: 68312 ccctggagaagggaaaggctacccactccagtattc 68347 Score = 87.7 bits (44), Expect = 6e-15 Identities = 83/96 (86%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||| || ||| ||| |||||| ||||| ||| |||||| || Sbjct: 97777 tggtaaagaatccacctgcattgtgggagacctgggttctatcccttggttgggaaggtc 97718 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||||||||||||||||||||||||||||| Sbjct: 97717 ccctggagaagggaatggctacccactccagtattc 97682 Score = 75.8 bits (38), Expect = 2e-11 Identities = 59/66 (89%) Strand = Plus / Minus Query: 404 gcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaaga 463 |||| |||||| |||||||||| |||||||||| ||||||||||| | |||||| ||||| Sbjct: 32363 gcctggagaatcccacggacagaggagcctggcaggctacagtccatggggttgcaaaga 32304 Query: 464 gttgga 469 |||||| Sbjct: 32303 gttgga 32298 Score = 73.8 bits (37), Expect = 9e-11 Identities = 58/65 (89%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 97520 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 97461 Query: 430 gcctg 434 ||||| Sbjct: 97460 gcctg 97456 Score = 71.9 bits (36), Expect = 4e-10 Identities = 57/64 (89%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 20561 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacagagga 20502 Query: 430 gcct 433 |||| Sbjct: 20501 gcct 20498 Score = 71.9 bits (36), Expect = 4e-10 Identities = 85/100 (85%), Gaps = 1/100 (1%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| |||| |||||||| | || ||||||||||| ||||| Sbjct: 90422 cctgggttgggaagatcccctggaggtgggaatggttgtcctctccagtattc-tgcctg 90364 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 |||||| || |||||| ||||||||||||||| |||||| Sbjct: 90363 gagaatcacaaggacagaggagcctggcgggctgcagtcc 90324 Score = 67.9 bits (34), Expect = 6e-09 Identities = 91/110 (82%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||| | ||| ||||| |||||| ||| |||| ||||| Sbjct: 13541 ggagaaggaaatggcaacccactccaatgttcttgcctggagaatcccagggacggggga 13482 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaa 479 |||||| ||||| | ||| || |||| | | ||||| ||| ||||||||| Sbjct: 13481 gcctggtgggctgctgtctctggggtcgcacagagtaggacacaactgaa 13432 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||| || |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 26359 ggagaaggaaatagcaacccactccagtgttcttgcctggagaatcccagggacggggga 26418 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 26419 gcctggtgggct 26430 Score = 61.9 bits (31), Expect = 3e-07 Identities = 58/67 (86%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| |||||||||| ||| ||| |||||| |||||||||||||||||| | Sbjct: 32103 ggtaaagaatccgcctgcaatgtgggagacctgggttcgatccctgggtggggaagatgc 32044 Query: 367 cccggag 373 || |||| Sbjct: 32043 cctggag 32037 Score = 58.0 bits (29), Expect = 5e-06 Identities = 53/61 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||||||||| |||||||||||| || | |||| |||||| |||||||||| ||| Sbjct: 32261 ggagaagggaatggttacccactccaggatcctcgcctggagaatcccacggacagagga 32202 Query: 430 g 430 | Sbjct: 32201 g 32201 >gb|CM000195| Bos taurus chromosome 19-FRAG[55890000,55989999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 168/192 (87%), Gaps = 1/192 (0%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||| ||||||||| ||| ||| ||||| |||||||||| ||||||||||| Sbjct: 86557 gtaaagaatctgactgcaatgcaggagacctgggtttggtccctgggtcgggaagatccc 86616 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| ||||||||||||||||||||||| ||||| |||||| || |||||| | Sbjct: 86617 ctggagaaggtaatggctacccactccagtattcttgcctggagaatcccctggacagag 86676 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgactca 487 |||||||| |||||||||||| | |||||| ||||||| ||| ||||||| ||||||| | Sbjct: 86677 gagcctggtgggctacagtccatggggttgcaaagagtaggacacaactg-agcgactaa 86735 Query: 488 cactttcacttt 499 || ||||||||| Sbjct: 86736 cattttcacttt 86747 Score = 117 bits (59), Expect = 7e-24 Identities = 137/163 (84%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||||||| ||| ||| || |||| ||||| || ||| || | || Sbjct: 43516 taaagaatctgcctgcaatgcaggagacctggattcaatccctcagtcaggatgaacgcc 43575 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||| ||||| ||||| |||||||||||||||| ||||| |||||| ||| |||||| || Sbjct: 43576 tggaaaagggcatggcaacccactccagtattcttgcctggagaatcccatggacagagg 43635 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttggata 471 |||||||||||||||||||| | |||||| ||| || |||||| Sbjct: 43636 agcctggcgggctacagtccatggggttgcaaatagctggata 43678 Score = 117 bits (59), Expect = 7e-24 Identities = 122/143 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||| ||||||||||||| | || ||| |||| |||||| ||||||||| |||||||| Sbjct: 81306 tggtagagaatctgcctgccaagcaggagacccaggttcaatccctgggtcaggaagatc 81365 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||| |||||| |||||||||||||| | ||||| | ||| ||| |||||| Sbjct: 81366 ccctggagaaggaaatggcaacccactccagtatccttgcctgggaaatcccaaggacag 81425 Query: 426 gggagcctggcgggctacagtcc 448 |||||||||||||||| ||||| Sbjct: 81426 aggagcctggcgggctatagtcc 81448 Score = 111 bits (56), Expect = 4e-22 Identities = 122/144 (84%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||| | ||| |||| | ||| |||||| || ||||||| Sbjct: 13770 atggtaaagaatctgcctgcaatacaggagacccagcttcgatccctgagtcaggaagat 13711 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| | |||||||||||||| ||||| |||||| ||| | ||| Sbjct: 13710 cccctggagaagggaatggcaaaccactccagtattcttgcctggagaatcccatgaaca 13651 Query: 425 ggggagcctggcgggctacagtcc 448 | | ||| ||| |||||||||||| Sbjct: 13650 gagcagcttggtgggctacagtcc 13627 Score = 97.6 bits (49), Expect = 6e-18 Identities = 119/141 (84%), Gaps = 1/141 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||| | ||| ||| || |||| | ||||| | ||||||| Sbjct: 8192 tggtaaagaatctgcctgcaattcaggagacc-ggattcaattcctggtgcgagaagatc 8134 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| ||||||||| ||||| ||||||||||||| || |||| ||||||| ||| | |||| Sbjct: 8133 ccctggagaagggcatggcaacccactccagtactcttgcccagagaatcccatgaacag 8074 Query: 426 gggagcctggcgggctacagt 446 ||||||||||||||| |||| Sbjct: 8073 aggagcctggcgggctgcagt 8053 Score = 97.6 bits (49), Expect = 6e-18 Identities = 118/141 (83%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||| | | ||| ||| ||| ||||||| ||| ||||| |||||||||| Sbjct: 46151 gtaaagaatctgcccgaagtgcaggagacctgggttcaatccttgggtcaggaagatccc 46092 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| ||||| ||||||||||||||| ||||| || ||| ||| || ||| | Sbjct: 46091 ctggagaaggaaatgggtacccactccagtatctttgcctggaaaatcccatgggcagag 46032 Query: 428 gagcctggcgggctacagtcc 448 |||||||| |||||||||||| Sbjct: 46031 gagcctggtgggctacagtcc 46011 Score = 89.7 bits (45), Expect = 2e-15 Identities = 93/109 (85%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| || |||| |||| |||||| | |||||| |||||||||||||| Sbjct: 92141 ggttcaatccctgggttggaaagagcccctggagaaagaaatggcaacccactccagtat 92200 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 || ||||| | ||| ||| || ||| |||||||||||||||||||||| Sbjct: 92201 tcttgcctgggaaatcccatggccagaggagcctggcgggctacagtcc 92249 Score = 89.7 bits (45), Expect = 2e-15 Identities = 123/145 (84%), Gaps = 3/145 (2%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||||||| ||||| ||| | | ||||| ||||||||| || ||||| Sbjct: 68330 tggtaaagaacctgcctgccaatgcaggagatgcaggttctatccctgggttgg-aagat 68388 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| ||||||||||||||| ||||| | ||| ||||||||| Sbjct: 68389 cccctggagaaggaaatggcaacccactccagtattgttgcctgggaaatcccacggaca 68448 Query: 425 ggggagcctggc-gggctacagtcc 448 | |||||||||| |||||||||||| Sbjct: 68449 gaggagcctggcggggctacagtcc 68473 Score = 89.7 bits (45), Expect = 2e-15 Identities = 87/101 (86%) Strand = Plus / Minus Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| |||||||||||||||| ||||| || ||| ||| ||||| Sbjct: 45530 cccctggagaaggaaatggcaacccactccagtattcttgcctggaaaattccatggaca 45471 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||| |||||||||||||||||| | |||| | ||||||| Sbjct: 45470 gaggaacctggcgggctacagtccatggggtcgcaaagagt 45430 Score = 87.7 bits (44), Expect = 6e-15 Identities = 113/136 (83%) Strand = Plus / Plus Query: 313 gaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccgga 372 ||||||||||||||||| | | || || |||| ||||||||||| || ||||||| ||| Sbjct: 2493 gaatctgcctgcaatgcagaagactcgagttcgatccctgggtggagaggatcccctgga 2552 Query: 373 gaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcc 432 ||||| |||||| ||||| |||||||||| ||||| |||||| | || ||| |||| | Sbjct: 2553 gaaggaaatggcaacccattccagtattcttgcctggagaatccagggggcagaggagac 2612 Query: 433 tggcgggctacagtcc 448 ||| |||||||||||| Sbjct: 2613 tggtgggctacagtcc 2628 Score = 85.7 bits (43), Expect = 2e-14 Identities = 115/139 (82%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| |||||||||||| || |||| |||| ||||| |||||||||||||||| |||| Sbjct: 38985 tccctgagtggggaagatctcctggaggagggcatggcaacccactccagtattcttgcc 39044 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| | | ||||| ||||||| | ||||| |||||| |||| | | ||||||| Sbjct: 39045 tggagaatcctatggacaaaggagcctagtgggctgcagtccataggatcgtgaagagtt 39104 Query: 467 ggatacaactgaagcgact 485 ||||| ||||||| |||| Sbjct: 39105 ggatatgactgaagggact 39123 Score = 85.7 bits (43), Expect = 2e-14 Identities = 52/55 (94%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||| |||||||||||| ||||||||||| |||||||||||||||||||| Sbjct: 64586 tccctgggttgggaagatcccctggagaagggaaaggctacccactccagtattc 64640 Score = 83.8 bits (42), Expect = 9e-14 Identities = 75/86 (87%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| |||||||| |||||| |||||||||||||||| ||||| Sbjct: 82998 cctgggtcaggaagatcccctggagaaggaaatggcaacccactccagtattcttgcctg 83057 Query: 409 gagaataccacggacaggggagcctg 434 || ||| ||| |||||| |||||||| Sbjct: 83058 gaaaatcccatggacagaggagcctg 83083 Score = 79.8 bits (40), Expect = 1e-12 Identities = 76/88 (86%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||||| |||||||||||| |||||| || |||| |||| ||||| |||||||||||| Sbjct: 84854 cgggttcgatccctgggtgggcaagatctcctggaggagggcatggcgacccactccagt 84795 Query: 398 attcatgcctagagaataccacggacag 425 |||| ||||| |||||| ||| |||||| Sbjct: 84794 attcttgcctggagaatcccatggacag 84767 Score = 77.8 bits (39), Expect = 6e-12 Identities = 99/119 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||| ||| |||| |||||||||||||||| ||| Sbjct: 69778 tccctgggtcaggaagatcccctggaggaggacatgggaacccactccagtattcttgct 69837 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 ||| |||| ||| |||||| ||| ||||| || |||| |||| |||||||| ||||||| Sbjct: 69838 tagggaattccatggacagaggaccctggtggactacggtccatagggttgtaaagagt 69896 Score = 77.8 bits (39), Expect = 6e-12 Identities = 88/103 (85%), Gaps = 1/103 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| ||||| ||| || ||||| || |||||| | |||||||| Sbjct: 6838 tggtaaagaatctgcctgccaatgcaggagacgcgggtgcaacccctggattgggaagat 6897 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcct 407 |||| ||||| || |||||| |||| ||||||||||| ||||| Sbjct: 6898 cccctggagacggaaatggcaacccgctccagtattcttgcct 6940 Score = 77.8 bits (39), Expect = 6e-12 Identities = 87/103 (84%) Strand = Plus / Minus Query: 312 agaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccgg 371 ||||||||||||| |||||||| ||| |||||| ||||||||| ||||||| || || Sbjct: 23691 agaatctgcctgccatgctggagacctgggttcgatccctgggtccggaagatggcctgg 23632 Query: 372 agaagggaatggctacccactccagtattcatgcctagagaat 414 | ||| ||||||| |||||||||||||||| |||| |||||| Sbjct: 23631 aaaagagaatggcgacccactccagtattccggcctggagaat 23589 Score = 73.8 bits (37), Expect = 9e-11 Identities = 97/117 (82%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| ||||||||||| ||| ||| |||| | |||||| ||||||||| Sbjct: 23171 ggtaaagaatccgcctgcaatgcaggagacctcagttcgatttctgggtcaggaagatcc 23230 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 | ||||||||||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 23231 gctggagaagggaagggctacccactccagtattctggcctggagaattccatggac 23287 Score = 71.9 bits (36), Expect = 4e-10 Identities = 91/106 (85%), Gaps = 5/106 (4%) Strand = Plus / Plus Query: 347 tccctgggtg-gggaagatccccc---ggagaagggaatggctacccactccagtattca 402 |||||||||| ||||||||||| | |||||||| |||||| ||| |||||||||||| Sbjct: 88636 tccctgggtgtgggaagatcccacccaggagaaggaaatggcaacc-actccagtattct 88694 Query: 403 tgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||| |||||| ||| ||| || |||||||||| ||||||||||| Sbjct: 88695 tgcctggagaatcccatggatagaggagcctggcaggctacagtcc 88740 Score = 71.9 bits (36), Expect = 4e-10 Identities = 75/88 (85%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| ||| |||||| |||||||| |||| || |||| Sbjct: 77112 tccctgggttgggaagatccccaggagtaggaaatggcaacccactctagtaatcttgcc 77171 Query: 407 tagagaataccacggacaggggagcctg 434 | || ||| |||||||||| | |||||| Sbjct: 77172 tggaaaatcccacggacagagcagcctg 77199 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| |||||||||||| ||| ||| ||||| Sbjct: 1287 ggagaaggaaatggcaacccactccagtattcttgcctagagaatcccagggatggggga 1346 Query: 430 gcctggcgggct 441 | |||| ||||| Sbjct: 1347 gactggtgggct 1358 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 75616 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 75557 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 75556 gcctggtgggct 75545 Score = 69.9 bits (35), Expect = 1e-09 Identities = 107/129 (82%), Gaps = 4/129 (3%) Strand = Plus / Minus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 ||||| || |||||||||||| ||||||||||||| ||||||||||||| | ||||| Sbjct: 55867 ccctgagtcgggaagatcccc---agaagggaatggcaacccactccagtacttttgcct 55811 Query: 408 agagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttg 467 |||||| ||| |||||| | |||||| |||||||||| | | |||||| |||||||| Sbjct: 55810 ggagaattccatggacagagtggcctggtgggctacagttcatggggttg-caagagttg 55752 Query: 468 gatacaact 476 || |||||| Sbjct: 55751 gacacaact 55743 Score = 67.9 bits (34), Expect = 6e-09 Identities = 67/78 (85%) Strand = Plus / Plus Query: 355 tggggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||||||||| |||| ||| |||||| |||||||||||||||| ||||| | ||| Sbjct: 75872 tggggaagatcccctggaggaggaaatggcaacccactccagtattcttgcctgggaaat 75931 Query: 415 accacggacaggggagcc 432 ||||||||| |||||| Sbjct: 75932 ttcacggacagaggagcc 75949 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| ||| |||||| ||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 40245 ggaggaggaaatggcaccccactccagtgttcttgcctggagaatcccagggacagggga 40186 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 40185 gcctggtgggct 40174 Score = 63.9 bits (32), Expect = 9e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcggg 439 ||||| |||||||||||||||| ||||| || ||| ||| ||| || |||||||||||| Sbjct: 68859 atggcaacccactccagtattcttgcctggaaaatcccatggagagaagagcctggcggg 68800 Query: 440 ctacagtc 447 |||||||| Sbjct: 68799 ctacagtc 68792 Score = 61.9 bits (31), Expect = 3e-07 Identities = 58/67 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| ||| |||||||| ||| |||| Sbjct: 21369 tccctgggtcgggaagatcccctggaggagggcatggcaacctactccagtgttcttgcc 21428 Query: 407 tagagaa 413 | ||||| Sbjct: 21429 tggagaa 21435 >gb|CM000193| Bos taurus chromosome 17-FRAG[9180000,9279999] Length = 100000 Score = 182 bits (92), Expect = 1e-43 Identities = 131/144 (90%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| ||| |||||||||||| ||||||||||||| Sbjct: 16050 atggtaaagaatctgcctgcagtgcaggagacctgggttcagtcccagggtggggaagat 16109 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || |||||||||||||||| ||||||||||||||| |||||||||||| ||| ||||| Sbjct: 16110 cgcctggagaagggaatggctgcccactccagtattcctgcctagagaattccagggaca 16169 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||||||||| ||||| Sbjct: 16170 gaggagcctggcgggctaaagtcc 16193 Score = 133 bits (67), Expect = 1e-28 Identities = 125/143 (87%), Gaps = 1/143 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||||| |||||||||| ||| ||||||||||| | ||| ||| ||||||||| Sbjct: 43305 ggtaaagaatctccctgcaatgcaggagacccgggttcaattcctaggtcaggaagatcc 43364 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggacag 425 || || ||||| |||||| |||||||||||||||| || ||||||||| ||| |||||| Sbjct: 43365 cctggcgaaggaaatggcaacccactccagtattcttggctagagaatccccatggacag 43424 Query: 426 gggagcctggcgggctacagtcc 448 |||||||||||||||||||||| Sbjct: 43425 aggagcctggcgggctacagtcc 43447 Score = 113 bits (57), Expect = 1e-22 Identities = 90/101 (89%) Strand = Plus / Minus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| |||||||||||| |||||||||||||||||||||||| ||||||| ||||| Sbjct: 53680 ccctgggttgggaagatcccctggagaagggaatggctacccactctagtattcttgcct 53621 Query: 408 agagaataccacggacaggggagcctggcgggctacagtcc 448 |||||| ||| |||||| |||| |||| ||| |||||||| Sbjct: 53620 ggagaatcccaaggacagaggagtctggtgggttacagtcc 53580 Score = 109 bits (55), Expect = 2e-21 Identities = 118/139 (84%) Strand = Plus / Plus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 ||||||||||||||||| ||| |||| ||||| |||||| ||||||||||||| | Sbjct: 51754 aaagaatctgcctgcaaaagaggagacccaggttcgatccctgtgtggggaagatccact 51813 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||||||||| |||||||||||||||| ||||| |||||| ||| |||||| | | Sbjct: 51814 agagaagggaatggcaacccactccagtattcttgcctggagaattccatggacagagaa 51873 Query: 430 gcctggcgggctacagtcc 448 ||||| |||||||||||| Sbjct: 51874 gcctgcagggctacagtcc 51892 Score = 105 bits (53), Expect = 3e-20 Identities = 125/149 (83%) Strand = Plus / Minus Query: 315 atctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggaga 374 |||||| |||||||| ||| ||| |||||| ||||||||| |||| ||||||| | ||| Sbjct: 99945 atctgcttgcaatgcgggagaccagggttcgatccctgggttgggaggatcccctgaaga 99886 Query: 375 agggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctg 434 ||| |||||| ||||| |||||||||| ||||| |||||| ||| ||| | |||||||| Sbjct: 99885 aggaaatggcaacccaatccagtattcttgcctggagaatcccatggatggaggagcctg 99826 Query: 435 gcgggctacagtccctagggttgaaaaga 463 | |||||||||||| | |||||| ||||| Sbjct: 99825 gtgggctacagtccatggggttgcaaaga 99797 Score = 103 bits (52), Expect = 1e-19 Identities = 85/96 (88%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||| |||||||||| ||| ||| |||||| ||||| ||| ||||||||| Sbjct: 97243 tggtaaagaatctccctgcaatgcgggagacctgggttcgatcccttggttgggaagatc 97302 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | ||||||||||| |||||||||||||||||||| Sbjct: 97303 cactggagaagggaaaggctacccactccagtattc 97338 Score = 103 bits (52), Expect = 1e-19 Identities = 94/108 (87%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||| ||||||||||||||||||||||| || || || ||| | Sbjct: 89808 ggaagatcccctggagaaggaaatggctacccactccagtattcttgtctggaaaatcct 89749 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| |||||||||| ||||||||||| | |||||| ||||||| Sbjct: 89748 atggacagaggagcctggcaggctacagtccatggggttgcaaagagt 89701 Score = 101 bits (51), Expect = 4e-19 Identities = 85/95 (89%), Gaps = 1/95 (1%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| ||||||||||| ||||| ||||||||| Sbjct: 95560 tggtaaagaatccacctgcaatgacggagacctgggttcagtcc-tgggttgggaagatc 95618 Query: 366 ccccggagaagggaatggctacccactccagtatt 400 ||| ||||||||||| ||||||||||||||||||| Sbjct: 95619 ccctggagaagggaaaggctacccactccagtatt 95653 Score = 93.7 bits (47), Expect = 1e-16 Identities = 108/127 (85%), Gaps = 1/127 (0%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| ||||||||| || |||| |||| ||||| |||||||||||||| Sbjct: 77631 ggttcaatccctgggttgggaagatctcctggaggagggcatggcaacccactccagtat 77690 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttg-a 458 | ||||| |||||| ||| |||||| |||||||||| ||| || |||| | |||||| | Sbjct: 77691 ttttgcctggagaattccatggacagaggagcctggcaggccacggtccatggggttgca 77750 Query: 459 aaagagt 465 ||||||| Sbjct: 77751 aaagagt 77757 Score = 93.7 bits (47), Expect = 1e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||| |||||||||| ||| |||| |||| ||| ||||| ||||||||| Sbjct: 58732 tggtaaagaatctacctgcaatgcaggagaccctggtttgatccgtgggttgggaagatc 58673 Query: 366 ccccggagaagggaatggctacccactccagtatt 400 | |||||||||||| ||||||||||||||||||| Sbjct: 58672 caccggagaagggacaggctacccactccagtatt 58638 Score = 93.7 bits (47), Expect = 1e-16 Identities = 86/99 (86%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||| ||||||| |||| ||| |||||| |||||||||||||| ||||| |||||| | Sbjct: 2324 gggaggatcccctggaggaggaaatggcagtccactccagtattcgtgcctggagaatcc 2383 Query: 417 cacggacaggggagcctggcgggctacagtccctagggt 455 || |||||| ||||||||| ||||||||||||||||||| Sbjct: 2384 catggacagaggagcctggtgggctacagtccctagggt 2422 Score = 91.7 bits (46), Expect = 4e-16 Identities = 91/106 (85%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 |||| ||||| |||||||||| | | |||| |||||||||||||||| | ||||| |||| Sbjct: 25493 taaacaatcttcctgcaatgcagaagacccaggttcagtccctgggttgagaagaccccc 25552 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||||||| | ||||| |||||||||| ||||| |||||| Sbjct: 25553 tggagaagggaatgacaacccattccagtattcttgcctggagaat 25598 Score = 89.7 bits (45), Expect = 2e-15 Identities = 138/169 (81%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||||||||||||| ||| | || |||||| ||||||||| |||||||||||| Sbjct: 83369 aaagaatctgcctgcaatgcaggagatccaggttcaatccctgggtcgggaagatcccct 83310 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||| ||||| ||||||| |||||||| ||| | | ||| | |||||| ||| Sbjct: 83309 ggagaagaaaatggaaacccactgcagtattcttgcatggcaaatcctgtggacagagga 83250 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||| ||||||||| || | |||| | |||||| |||| || ||||| Sbjct: 83249 gcctggtgggctacagaccatggggtcgcaaagagctggacacgactga 83201 Score = 85.7 bits (43), Expect = 2e-14 Identities = 70/79 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| || ||| |||||||||||||||| ||||| |||||| || |||||| ||| Sbjct: 86786 ggagaaggaaacggcaacccactccagtattcttgcctggagaatctcatggacagagga 86727 Query: 430 gcctggcgggctacagtcc 448 ||||||||||||||||||| Sbjct: 86726 gcctggcgggctacagtcc 86708 Score = 83.8 bits (42), Expect = 9e-14 Identities = 79/90 (87%), Gaps = 1/90 (1%) Strand = Plus / Plus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||| ||| |||||| |||||||||||||||| ||||| || ||| ||| Sbjct: 21436 gaagatcccctggaggaggaaatggcaacccactccagtattcttgcctgga-aatccca 21494 Query: 419 cggacaggggagcctggcgggctacagtcc 448 |||||| |||||||||| ||||||||||| Sbjct: 21495 tggacagaggagcctggcaggctacagtcc 21524 Score = 81.8 bits (41), Expect = 4e-13 Identities = 92/109 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| || ||||||| ||||| | ||||||| |||||||| Sbjct: 7658 tggtaaagaatctgcctgcagtgtaagaaacccaggttcgatacctgggttaggaagatc 7717 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||| |||||||| ||||| |||||||| ||||||| ||||| |||||| Sbjct: 7718 ccctggagaaggacatggcaacccactcaagtattcttgcctggagaat 7766 Score = 79.8 bits (40), Expect = 1e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 |||| |||||| ||||||||| |||||| |||||||||| |||| |||||||||||| || Sbjct: 84329 ggaacatcccctggagaagggcatggctgcccactccaggattcttgcctagagaatccc 84388 Query: 418 acggacaggggagcctggcgggct 441 |||||| |||||||||| |||| Sbjct: 84389 ttggacagaggagcctggcaggct 84412 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| ||| ||| |||| ||||| | ||||||| ||||||||| Sbjct: 97124 tggtaaagaatctgcctgcactgcaggagaccccggttcgattcctgggtcgggaagatc 97183 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | |||||||||| ||||||||||||||| |||| Sbjct: 97184 cggtggagaagggataggctacccactccaggattc 97219 Score = 77.8 bits (39), Expect = 6e-12 Identities = 87/103 (84%) Strand = Plus / Plus Query: 346 gtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgc 405 |||||||||||||||| |||||| |||| |||| || || | ||||||||| | || ||| Sbjct: 18008 gtccctgggtggggaacatcccctggaggagggcatagcaagccactccagcactcttgc 18067 Query: 406 ctagagaataccacggacaggggagcctggcgggctacagtcc 448 || ||||| || |||||| |||||||||||||||||||||| Sbjct: 18068 ctggagaagctcatggacagaggagcctggcgggctacagtcc 18110 Score = 73.8 bits (37), Expect = 9e-11 Identities = 91/109 (83%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||| ||||||||||| ||| || |||| ||||||| | ||||||||| Sbjct: 58613 tggtaaagaatgtgcctgcaatgtgggagtccttggtttgatccctggattgggaagatc 58554 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 || ||||||||||| ||||||||||||||||||| ||||||||||| Sbjct: 58553 tcctggagaagggaaaggctacccactccagtattgtggcctagagaat 58505 Score = 71.9 bits (36), Expect = 4e-10 Identities = 96/116 (82%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 25376 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 25317 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||| | | ||||||||| || |||||||||||| Sbjct: 25316 gcctggtgggctgctgtctatggggtggcacagagttggacacgactgaagcgact 25261 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||||| |||| Sbjct: 98325 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacaaggga 98266 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 98265 gcctggtgggct 98254 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 73170 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 73229 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 73230 gcctggtgggct 73241 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 35283 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 35342 Query: 430 gcctgg 435 |||||| Sbjct: 35343 gcctgg 35348 Score = 65.9 bits (33), Expect = 2e-08 Identities = 45/49 (91%) Strand = Plus / Plus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||||| |||||||| |||||| |||||||||||||||| ||||| Sbjct: 14891 gaagatcccctggagaaggaaatggcaacccactccagtattcttgcct 14939 Score = 63.9 bits (32), Expect = 9e-08 Identities = 104/128 (81%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 ||||||||||||||| |||||| ||| |||| |||| ||||| ||||| |||||||| Sbjct: 23153 ggttcagtccctgggcccggaagaccccttggaggagggcatggcaacccattccagtat 23212 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || | || ||||| || |||||| | ||||||| ||||||||| || |||||||| | Sbjct: 23213 tcttaccagaagaatcccggggacagagtagcctggtgggctacagcccatagggttgca 23272 Query: 460 aagagttg 467 |||||||| Sbjct: 23273 aagagttg 23280 Score = 61.9 bits (31), Expect = 3e-07 Identities = 64/75 (85%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| | ||||||||| |||||| ||||||||| ||| |||| Sbjct: 43175 cctgggttgggaagatcccctgaagaagggaaaggctacacactccagtgttctggcctg 43234 Query: 409 gagaataccacggac 423 |||||| ||| |||| Sbjct: 43235 gagaattccatggac 43249 Score = 61.9 bits (31), Expect = 3e-07 Identities = 94/115 (81%) Strand = Plus / Plus Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | |||| Sbjct: 74596 gagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggaggag 74655 Query: 431 cctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 | ||| ||||| ||||| || |||| | | ||||| ||| | |||||||||||| Sbjct: 74656 cttggtgggctgcagtctctggggtcgcacagagtcggacatgactgaagcgact 74710 >gb|CM000185| Bos taurus chromosome 9-FRAG[51390000,51489999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 169/195 (86%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||||||||| |||||| || || |||| Sbjct: 58023 atggtaaagaatctgcctgcaatgcaggagacccgggttccatccctgtgtcaggcagat 57964 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| |||||||||||||| | | | ||||||| ||| ||||| Sbjct: 57963 cccctggagaagggaatggcgacccactccagtatgcttccagagagaattccatggaca 57904 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 ||||||||||| |||||||||||| | |||||| ||||||| ||| || ||||||||||| Sbjct: 57903 ggggagcctggtgggctacagtccatggggttgcaaagagtcggacacgactgaagcgac 57844 Query: 485 tcacactttcacttt 499 | |||||| |||||| Sbjct: 57843 tgacacttccacttt 57829 Score = 111 bits (56), Expect = 4e-22 Identities = 138/164 (84%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||| |||||||| ||||| |||||| ||| || ||||||||| ||||||| Sbjct: 4533 tggtaaagaagctgcctgccaatgcaggaaacataggtccaatccctgggtctggaagat 4474 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| || ||||| |||| | |||||||||||||| ||||| |||||| ||| ||||| Sbjct: 4473 cccctggggaaggaaatgacagtccactccagtattcttgcctggagaattccatggaca 4414 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgg 468 | ||||||||| |||||||||||| | |||||| |||||||||| Sbjct: 4413 gaggagcctggtgggctacagtccatggggttgcaaagagttgg 4370 Score = 107 bits (54), Expect = 6e-21 Identities = 102/118 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| || ||| ||||| ||||||||| ||||||||| Sbjct: 99155 tggtaaagaatctgcctgcaatgcaggggacctaggttcgatccctgggttgggaagatc 99214 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||| ||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 99215 ccctggagaagagaaaggctacccactccagtattctggcctggagaattccatggac 99272 Score = 87.7 bits (44), Expect = 6e-15 Identities = 104/124 (83%) Strand = Plus / Minus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| ||||||||| |||||||||| | ||||||| ||||| ||||||||||||||| Sbjct: 19853 gttcaatccctgggttgggaagatcctctggagaagaatatggcaacccactccagtatt 19794 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaa 460 | ||||| || ||| ||| ||||| ||||| ||||||||||| |||| | |||||| || Sbjct: 19793 cttgcctggaaaatcccatagacagaggagcttggcgggctactgtccttggggttgcaa 19734 Query: 461 agag 464 |||| Sbjct: 19733 agag 19730 Score = 75.8 bits (38), Expect = 2e-11 Identities = 107/130 (82%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| | ||||| || |||||| |||||||||||||||| || ||| Sbjct: 61017 ggttcaatccctgggtcagaaagatttcctggagaaaggaatggctacccacttcaatat 60958 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || |||||||||| ||| |||||| ||||| ||| |||||||||||| |||| | | Sbjct: 60957 tcttgcctagagacgtccatggacagaggagcttggtgggctacagtccacggggtcgca 60898 Query: 460 aagagttgga 469 |||||||||| Sbjct: 60897 aagagttgga 60888 Score = 73.8 bits (37), Expect = 9e-11 Identities = 92/109 (84%), Gaps = 1/109 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||| |||||||||||| ||| ||| | ||| ||||||||| | ||||||| Sbjct: 66964 tggtaaagaatttgcctgcaatgcaggagacctgagtttgatccctgggttgagaagatc 66905 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||||||||| ||||| || |||||||||| |||| |||||| Sbjct: 66904 ccccggagaagggaa-agctactcattccagtattctggcctggagaat 66857 Score = 69.9 bits (35), Expect = 1e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||||| || |||||||||||| |||||||| |||||| |||||||||||||||| Sbjct: 70673 tccctgagtcgggaagatcccctggagaaggaaatggcaacccactccagtattc 70727 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 27115 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 27174 Query: 430 gcctgg 435 |||||| Sbjct: 27175 gcctgg 27180 Score = 65.9 bits (33), Expect = 2e-08 Identities = 79/93 (84%), Gaps = 1/93 (1%) Strand = Plus / Plus Query: 387 cccactccagtattcatgcctagagaataccacggacaggggagcctggc-gggctacag 445 ||||||||||||||| ||||| |||||| ||| |||||||||| || ||| ||| ||||| Sbjct: 35630 cccactccagtattcttgcctggagaattccatggacaggggacccaggcagggttacag 35689 Query: 446 tccctagggttgaaaagagttggatacaactga 478 ||| | ||||| ||||||||| | |||||||| Sbjct: 35690 tccatggggttacaaagagttgtacacaactga 35722 Score = 63.9 bits (32), Expect = 9e-08 Identities = 50/56 (89%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 77596 ggagaaggcaatggcaacccactccagtattcttgcctggagaatcccagggacag 77651 Score = 63.9 bits (32), Expect = 9e-08 Identities = 104/128 (81%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||||| ||||||||||| |||||||| |||| ||| |||||| |||||||||||| Sbjct: 38047 cgggttcgatccctgggtggagaagatcctgtggagtaggaaatggcaacccactccagt 37988 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 | | ||||| || ||| ||| |||||| ||| | |||| ||||||||||| | ||||| Sbjct: 37987 gtccttgcctggaaaattccatggacagaggaacatggcaggctacagtccttggggttt 37928 Query: 458 aaaagagt 465 ||||||| Sbjct: 37927 caaagagt 37920 Score = 63.9 bits (32), Expect = 9e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 25157 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 25216 Query: 430 gcct 433 |||| Sbjct: 25217 gcct 25220 Score = 61.9 bits (31), Expect = 3e-07 Identities = 85/103 (82%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||| |||||| ||| ||| ||| ||||| ||||||||| ||||||| Sbjct: 2008 tggtaaagaatctccctgcagtgcaggagacctgggtttgatccctgggtcaggaagata 1949 Query: 366 ccccggagaagggaatggctacccactccagtattcatgccta 408 ||| |||| ||| |||||| |||| ||| ||||||| |||||| Sbjct: 1948 ccctggaggaggaaatggcaaccctctctagtattcttgccta 1906 Score = 60.0 bits (30), Expect = 1e-06 Identities = 111/137 (81%), Gaps = 2/137 (1%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaag--ggaatggctacccactccagtattcatg 404 ||||||||| |||||||||||| |||| | || ||||| |||| |||||||||| || Sbjct: 22203 tccctgggttgggaagatcccctggagggggaggcatggcaaccctctccagtatttttg 22262 Query: 405 cctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagag 464 ||| ||||| ||| |||||| | ||||||| |||||| ||||| | |||||| ||| || Sbjct: 22263 cctgcagaatcccatggacagagcagcctggtgggctatagtccatggggttgcaaaaag 22322 Query: 465 ttggatacaactgaagc 481 | ||| |||| |||||| Sbjct: 22323 tgggacacaattgaagc 22339 Score = 58.0 bits (29), Expect = 5e-06 Identities = 62/73 (84%) Strand = Plus / Plus Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||| ||||| ||||||||||| ||| ||||| |||||| ||| |||| |||| Sbjct: 48423 cggagaaggcgatggcaccccactccagtgttcttgcctggagaatcccaaggacggggg 48482 Query: 429 agcctggcgggct 441 ||||||| ||||| Sbjct: 48483 agcctggtgggct 48495 Score = 58.0 bits (29), Expect = 5e-06 Identities = 56/65 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| || ||||| |||||| ||| |||| ||||| Sbjct: 3924 ggagaaggaaatggcaacccactccagtgttattgcctggagaatcccagggacggggga 3983 Query: 430 gcctg 434 ||||| Sbjct: 3984 gcctg 3988 >gb|CM000185| Bos taurus chromosome 9-FRAG[35460000,35559999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 148/167 (88%) Strand = Plus / Plus Query: 312 agaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccgg 371 |||||||||||||||||| ||| ||| | ||||| ||||||||| ||||||||||||||| Sbjct: 77929 agaatctgcctgcaatgcaggagacctgagttcaatccctgggttgggaagatcccccgg 77988 Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||||||| ||||||||||||||||||| |||||||||||| ||| | |||| | || Sbjct: 77989 agaagggaatagctacccactccagtattcttgcctagagaattccatgaacagagttgc 78048 Query: 432 ctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 ||||| ||||||||||| | |||||| ||||||||||| |||||||| Sbjct: 78049 ctggcaggctacagtccatggggttgcaaagagttggacacaactga 78095 Score = 141 bits (71), Expect = 5e-31 Identities = 125/143 (87%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| |||| ||||| || ||||||| ||||||||| Sbjct: 67598 tggtaaagaatctgcctgcaatgcaggagacccaggttcggttcctgggttgggaagatc 67657 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||| ||||| |||||||||||||||| ||||| || ||| ||| || ||| Sbjct: 67658 ccctggagaaggaaatggtaacccactccagtattcttgcctggaaaatcccatgggcag 67717 Query: 426 gggagcctggcgggctacagtcc 448 |||||||||| ||||||||||| Sbjct: 67718 aggagcctggcaggctacagtcc 67740 Score = 125 bits (63), Expect = 3e-26 Identities = 117/135 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| | ||||||||||||||| |||| ||||| |||||||| |||||| |||| Sbjct: 39066 tccctgggttgagaagatcccccggaggagggcatggcaacccactctagtatttttgcc 39007 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| ||||||||| |||||| ||||| ||||||||||||||||| Sbjct: 39006 tggagaatcccatggacagaggagcctggtgggctaaagtccatagggttgaaaagagtt 38947 Query: 467 ggatacaactgaagc 481 || || |||||||| Sbjct: 38946 gggcacgactgaagc 38932 Score = 117 bits (59), Expect = 7e-24 Identities = 122/143 (85%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| |||||||||||||||||||||| |||| |||| ||||| | ||||||||||| Sbjct: 46277 gggttcaatccctgggtggggaagatcccctggaggagggcatggcaaaccactccagta 46336 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 ||| ||| | |||||| ||| |||||| ||||||| |||||||||||| ||| || | Sbjct: 46337 ttcttgcttggagaatcccatggacagaacagcctggtgggctacagtccatagcgtcgc 46396 Query: 459 aaagagttggatacaactgaagc 481 ||||||| ||| ||||||||||| Sbjct: 46397 aaagagtcggacacaactgaagc 46419 Score = 85.7 bits (43), Expect = 2e-14 Identities = 89/103 (86%), Gaps = 1/103 (0%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| || |||| |||| ||||||||||||||| ||||||||| |||||| |||| Sbjct: 29049 tccctgggttggaaagagcccctggagaagggaatggcaacccactcctgtattcttgcc 28990 Query: 407 tagagaat-accacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||||| ||||| |||| ||||||||||| Sbjct: 28989 tggagaatccccatggacagaggagcatggcaggctacagtcc 28947 Score = 73.8 bits (37), Expect = 9e-11 Identities = 55/61 (90%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| ||||||| |||||| |||||||||||||||| |||| Sbjct: 71543 tccctgggtcgggaagatcccctagagaaggaaatggcaacccactccagtattcttgcc 71484 Query: 407 t 407 | Sbjct: 71483 t 71483 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 43079 ggagaaggaaatggcagcccactccagtgttcttgcctggagaatcccagggacagggga 43138 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 43139 gcctggtgggct 43150 Score = 71.9 bits (36), Expect = 4e-10 Identities = 117/144 (81%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||| |||| | ||| ||| |||| ||||| ||||| || |||||||| Sbjct: 17257 atggtaaagaatccacctgtagtgcaggagacccaggttctacccctgcgttgggaagat 17316 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| | ||||||||||| | | ||| |||||||||| ||||| |||||| |||| |||| Sbjct: 17317 cccctgaagaagggaatgccaatccattccagtattcttgcctggagaattccacagaca 17376 Query: 425 ggggagcctggcgggctacagtcc 448 | ||| ||| |||||||||||| Sbjct: 17377 gaggactctgctgggctacagtcc 17400 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 45164 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 45105 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 45104 gcctggtgggct 45093 Score = 67.9 bits (34), Expect = 6e-09 Identities = 104/126 (82%), Gaps = 1/126 (0%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| |||||||| || |||||||| |||| | ||||| || ||||| Sbjct: 93821 ggttcaatccctgggtcaggaagatctcctggagaaggaaatgacaacccagtcaagtat 93880 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || ||||| || ||| ||| |||| | |||||||||| ||||||||||| |||||| | Sbjct: 93881 tcttgcct-gaaaatcccatggactgaggagcctggcaggctacagtccaaagggttaca 93939 Query: 460 aagagt 465 |||||| Sbjct: 93940 aagagt 93945 Score = 65.9 bits (33), Expect = 2e-08 Identities = 87/104 (83%), Gaps = 2/104 (1%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| ||||| |||||| ||| |||| Sbjct: 32247 tccctgggttgggaagatcccctggaggagggcatggcaacccattccagtgttcttgcc 32306 Query: 407 tagagaa--taccacggacaggggagcctggcgggctacagtcc 448 | ||||| ||| ||||| ||||| |||||||||||||||| Sbjct: 32307 tggagaagtgcccatggacaaaggagcttggcgggctacagtcc 32350 Score = 60.0 bits (30), Expect = 1e-06 Identities = 90/110 (81%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||| | ||| || |||| |||||||| |||||| ||||||||||| | Sbjct: 82394 gggttcaatccctggttcaggacgaccccctggagaaggaaatggcaacccactccagga 82335 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| | ||| |||| | || |||||| ||||||||| ||||| |||||| Sbjct: 82334 ttcttacctggagagtttcatggacagaggagcctggtgggctgcagtcc 82285 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 68444 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 68503 Query: 430 gcctgg 435 |||||| Sbjct: 68504 gcctgg 68509 >gb|CM000183| Bos taurus chromosome 7-FRAG[57060000,57159999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 151/171 (88%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||| ||||||||| ||| ||| ||||||| ||||||||| |||||||||| Sbjct: 78178 gtaaagaatctggctgcaatgcaggagacctgggttcaatccctgggtcaggaagatccc 78237 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| |||||||| ||||||| ||||| |||||||||| |||||| | Sbjct: 78238 ctggagaaggaaatggcaacccactctagtattcttgcctggagaataccatggacagag 78297 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||||| |||||||||||| | |||||| ||||||||||| |||||||| Sbjct: 78298 gagcctggtgggctacagtccatggggttgcaaagagttggacacaactga 78348 Score = 123 bits (62), Expect = 1e-25 Identities = 110/126 (87%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| ||||||| |||||||| || ||||| Sbjct: 12374 atggtaaagaatctgcctgcaatgcaggagacctgggttcaatccctgggaaggtaagat 12315 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 || | |||||||| ||||||||||||||||||||||| ||||| ||||| ||| ||||| Sbjct: 12314 ccactggagaaggtaatggctacccactccagtattcttgcctggagaagtccatggaca 12255 Query: 425 ggggag 430 | |||| Sbjct: 12254 gaggag 12249 Score = 107 bits (54), Expect = 6e-21 Identities = 81/90 (90%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||| ||| |||||| |||||||||||||||| ||||| |||||| ||| Sbjct: 70296 gaagatcccctggaggaggaaatggcaacccactccagtattcttgcctggagaatccca 70237 Query: 419 cggacaggggagcctggcgggctacagtcc 448 |||||| |||||||||||||||||||||| Sbjct: 70236 tggacagaggagcctggcgggctacagtcc 70207 Score = 99.6 bits (50), Expect = 2e-18 Identities = 108/126 (85%), Gaps = 1/126 (0%) Strand = Plus / Minus Query: 320 cctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggga 379 |||||||||| ||| || ||||||||||||||| || ||||||||||| |||| |||| Sbjct: 52315 cctgcaatgcaggagactcgggttcagtccctgagttgggaagatcccttggaggagggc 52256 Query: 380 atggctacccactccagtattcatgcctagagaat-accacggacaggggagcctggcgg 438 ||||| |||||||||||||||| ||||| ||||| |||||||||| |||||||| || Sbjct: 52255 atggcaacccactccagtattcttgcctgaagaatccccacggacagaagagcctggtgg 52196 Query: 439 gctaca 444 |||||| Sbjct: 52195 gctaca 52190 Score = 97.6 bits (49), Expect = 6e-18 Identities = 112/133 (84%) Strand = Plus / Plus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 ||||||| |||||| ||| ||||| ||| ||||||||| |||||||||||| |||||| Sbjct: 59943 tctgcctccaatgcgggagacccgagtttgatccctgggtcgggaagatcccctggagaa 60002 Query: 376 gggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 || ||||| |||||||||||||||| ||||| |||||| ||| |||| | | ||||||| Sbjct: 60003 ggaaatggtaacccactccagtattcttgcctggagaatcccatggacggagaagcctgg 60062 Query: 436 cgggctacagtcc 448 ||||||||||| Sbjct: 60063 taggctacagtcc 60075 Score = 85.7 bits (43), Expect = 2e-14 Identities = 91/107 (85%) Strand = Plus / Minus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| |||||||||||| |||| |||| ||||| ||||||||| ||| || ||||| Sbjct: 62721 ccctgggttgggaagatcccctggaggagggcatggcaacccactcctgtactcttgcct 62662 Query: 408 agagaataccacggacaggggagcctggcgggctacagtccctaggg 454 |||||| || | |||| |||||||||||||| ||||||| ||||| Sbjct: 62661 ggagaatctcatgcacagaggagcctggcgggccacagtccataggg 62615 Score = 79.8 bits (40), Expect = 1e-12 Identities = 94/112 (83%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| ||| || | ||||| |||||||||||||||| ||||| || || || Sbjct: 63286 ggaagatcccctggaagagtgcatggcaacccactccagtattcttgcctggattatccc 63227 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 |||||| |||||||||| ||||||||||| | |||||| ||||||||||| Sbjct: 63226 ttggacagaggagcctggcaggctacagtccatggggttgcaaagagttgga 63175 Score = 75.8 bits (38), Expect = 2e-11 Identities = 80/94 (85%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||| || || ||||||||||||||||| |||||||||||||| ||||| Sbjct: 96303 cctgggtcaggaaggtcacctggagaagggaatggctagccactccagtattcttgcctg 96362 Query: 409 gagaataccacggacaggggagcctggcgggcta 442 | ||| ||| |||||| |||||||||| ||||| Sbjct: 96363 ggaaatcccatggacagaggagcctggcaggcta 96396 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 363 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 304 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 303 gcctggtgggct 292 Score = 71.9 bits (36), Expect = 4e-10 Identities = 117/144 (81%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| |||| || |||||| ||| ||| |||||| ||||||||| | |||||| Sbjct: 53913 atggtaaagcgtctgtctacaatgcgggagacctgggttcgatccctgggttgtgaagat 53972 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| | |||||| |||| | ||||| || ||| ||| ||||| Sbjct: 53973 cccctggagaaggaaatggcaatccactctagtactattgcctggaaaatcccatggaca 54032 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||| ||||||||||| Sbjct: 54033 gaggagcctgctaggctacagtcc 54056 Score = 69.9 bits (35), Expect = 1e-09 Identities = 106/128 (82%), Gaps = 5/128 (3%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| |||||||| ||||||| |||| Sbjct: 15234 tccctgggtcaggaagatcccctggagaaggaaatggcaacccactctagtattcttgcc 15293 Query: 407 tagag----aataccacggacaggggagcctggcgggctacagtccctagggt-tgaaaa 461 | ||| || ||| |||||| |||||||||| || |||||||| | |||| ||||| Sbjct: 15294 tggagtggatatcccatggacagaggagcctggcagggtacagtccatggggtcggaaaa 15353 Query: 462 gagttgga 469 |||||||| Sbjct: 15354 gagttgga 15361 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||||||| |||||| |||||||||||| ||| ||| | | ||| || Sbjct: 27359 ggaagatcccctggagaaggaaatggcaacccactccagtgttcttgcttgggaaatccc 27418 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| || |||||| |||||||||||| Sbjct: 27419 atggacagaggcgcctggtgggctacagtcc 27449 Score = 69.9 bits (35), Expect = 1e-09 Identities = 99/119 (83%), Gaps = 1/119 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||| | ||||| || ||||||| |||| Sbjct: 22028 tccctgggtcgggaagatcccctggaggagggcatgccaaccca-tctagtattcttgcc 22086 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| ||| |||||| ||||||| | |||||| ||||| ||| || | ||||||| Sbjct: 22087 tggagaattccatggacagaggagcctagtgggctatagtccatagagtcgcaaagagt 22145 Score = 65.9 bits (33), Expect = 2e-08 Identities = 75/89 (84%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||| || |||||| ||||||||||||||| |||| || ||| ||| Sbjct: 82709 gaagatcccctggaggagaaaatggcaacccactccagtatttttgccaggataatccca 82650 Query: 419 cggacaggggagcctggcgggctacagtc 447 |||||| |||||||||||||||| |||| Sbjct: 82649 tggacagaggagcctggcgggctatagtc 82621 Score = 63.9 bits (32), Expect = 9e-08 Identities = 56/64 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| ||| ||||| Sbjct: 16596 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggatggggga 16537 Query: 430 gcct 433 |||| Sbjct: 16536 gcct 16533 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 54261 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 54202 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 54201 gcctggtgggct 54190 Score = 63.9 bits (32), Expect = 9e-08 Identities = 87/104 (83%), Gaps = 1/104 (0%) Strand = Plus / Minus Query: 378 gaatggctacccactccagtattcatgcctagagaat-accacggacaggggagcctggc 436 ||||||| |||||||||||| ||| ||||| |||||| ||| |||||| ||||||| | Sbjct: 61257 gaatggcaacccactccagtgttcttgcctggagaatccccaaggacagaggagcctagt 61198 Query: 437 gggctacagtccctagggttgaaaagagttggatacaactgaag 480 |||||||||| | |||||| || ||||| ||| |||||||||| Sbjct: 61197 gggctacagttcatagggtccaagagagtcggacacaactgaag 61154 Score = 58.0 bits (29), Expect = 5e-06 Identities = 71/85 (83%) Strand = Plus / Plus Query: 373 gaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcc 432 |||||||||||| |||||||||||||||| |||| ||||| || |||||| |||||| Sbjct: 55718 gaagggaatggcaacccactccagtattctcgcctgaagaattccttggacagaggagcc 55777 Query: 433 tggcgggctacagtccctagggttg 457 || ||||| |||||| | |||||| Sbjct: 55778 tgatgggctgcagtccatggggttg 55802 >gb|CM000181| Bos taurus chromosome 5-FRAG[42750000,42849999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 137/151 (90%), Gaps = 1/151 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 7309 atggtaaagaatctgcctgcagtgcaggagacctgggttcgatccctgggttgggaagat 7250 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| |||||||||||| ||| |||| Sbjct: 7249 cccctggagaagggaatggctacccactccagtattcttgcctagagaattcca-tgaca 7191 Query: 425 ggggagcctggcgggctacagtccctagggt 455 | |||||||||||||||||||||| |||||| Sbjct: 7190 gaggagcctggcgggctacagtccatagggt 7160 Score = 139 bits (70), Expect = 2e-30 Identities = 124/142 (87%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 4350 atggtaaagaatctgcctgcaatgcaggagacctgggttcgatccctgggtcgggaagat 4409 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| || ||||||||||||| | ||| |||||| ||| ||||| Sbjct: 4410 cccctggagaaggaaatggcaacacactccagtattcttacctggagaatcccatggaca 4469 Query: 425 ggggagcctggcgggctacagt 446 | |||||||| |||||||||| Sbjct: 4470 gaggagcctgctgggctacagt 4491 Score = 131 bits (66), Expect = 4e-28 Identities = 123/142 (86%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||| | | || ||| |||||||| |||||||||| Sbjct: 78004 ggtaaagaatctgcctgcaatgcaggagagctggattcgatccctgggatgggaagatcc 77945 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||||||||||| |||||||||||| ||||||| ||||| |||||| ||| |||||| Sbjct: 77944 cctggagaagggaacggctacccactctagtattcttgcctggagaatcccatggacaga 77885 Query: 427 ggagcctggcgggctacagtcc 448 ||| ||||| |||||||||||| Sbjct: 77884 ggaccctggtgggctacagtcc 77863 Score = 109 bits (55), Expect = 2e-21 Identities = 125/147 (85%), Gaps = 1/147 (0%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||||||| ||| ||||| ||||| | ||||||||||| Sbjct: 51463 gggttcaatccctgggttgggaagatcccctggataaggggatggcaatccactccagta 51404 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 ||| ||| | ||| ||| |||||| |||||||||| ||||||||||| ||||||| Sbjct: 51403 ttctcacctgaaaaattccatggacagaggagcctggcaggctacagtccacagggttgc 51344 Query: 459 aaagagttggatacaactgaagcgact 485 ||||||||||| |||||| |||||||| Sbjct: 51343 aaagagttggacacaact-aagcgact 51318 Score = 101 bits (51), Expect = 4e-19 Identities = 84/95 (88%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| |||||| || |||||||||||| ||||||||||||||| | |||||||||||| Sbjct: 76660 ggttcaatccctgagttgggaagatcccctggagaagggaatggcaatccactccagtat 76601 Query: 400 tcatgcctagagaataccacggacaggggagcctg 434 || |||||||||||| ||| ||||| |||||||| Sbjct: 76600 tcttgcctagagaatcccatggacaaaggagcctg 76566 Score = 95.6 bits (48), Expect = 2e-17 Identities = 84/96 (87%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||| ||| | | ||||| ||||||||| ||||||||| Sbjct: 19595 tggtaaagaatctgcctgcaatatgggatatcggggtttgatccctgggttgggaagatc 19654 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| ||||||||||||||||||| |||||||||||| Sbjct: 19655 ccctggagaagggaatggctacctactccagtattc 19690 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 17222 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 17281 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 17282 gcctggtgggct 17293 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 15464 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 15405 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 15404 gcctggtgggct 15393 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||| |||||| |||| | || ||||| |||||||||||||||| |||| Sbjct: 59192 tccctgggttgggaatatcccctggaggatggcatggcaacccactccagtattcttgcc 59251 Query: 407 tagagaataccacggacaggggagcctggcgggcta 442 | || ||| ||| |||||| ||||||||||||||| Sbjct: 59252 tggaaaatcccatggacagaagagcctggcgggcta 59287 Score = 77.8 bits (39), Expect = 6e-12 Identities = 54/59 (91%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||||||||||||||| |||||||||||| |||| |||| ||||| |||||||||||| Sbjct: 63182 gggttcagtccctgggttgggaagatcccctggaggagggcatggcaacccactccagt 63124 Score = 71.9 bits (36), Expect = 4e-10 Identities = 94/112 (83%), Gaps = 1/112 (0%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 75397 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 75456 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagc 481 |||||| |||||| ||| |||||| | | ||||||||| || |||||||| Sbjct: 75457 gcctgg-tggctaccgtctatagggtcgcacagagttggacacgactgaagc 75507 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| || |||||| ||||||||||| |||||||| |||||| ||||||||||||| Sbjct: 9324 gggttcaatctctgggtcaggaagatcccctggagaaggaaatggcaacccactccagta 9265 Query: 399 ttcatgcctaga 410 || |||||||| Sbjct: 9264 ctcttgcctaga 9253 Score = 69.9 bits (35), Expect = 1e-09 Identities = 116/143 (81%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| | | |||||| ||||| || ||||||| Sbjct: 5872 tggtaaagaatccacctgcaatgcaggagaagcaggttcaatccctccgtttggaagatt 5931 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||| || ||||| |||||||||||||||| ||||| |||||| || |||||| Sbjct: 5932 ccctggagggggagatggcaacccactccagtattcttgcctggagaatcccttggacag 5991 Query: 426 gggagcctggcgggctacagtcc 448 ||||||| | |||||||||||| Sbjct: 5992 aggagcctagtgggctacagtcc 6014 Score = 69.9 bits (35), Expect = 1e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 360 aagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||| ||||||||||| |||||||||||||||||||| |||| |||||| Sbjct: 94111 aagatcccctggagaagggaaaggctacccactccagtattctggcctggagaat 94057 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 86439 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 86380 Query: 430 gcctgg 435 |||||| Sbjct: 86379 gcctgg 86374 Score = 67.9 bits (34), Expect = 6e-09 Identities = 86/102 (84%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| ||||||||| ||||||||||| |||| ||| ||||| |||||| ||||| || Sbjct: 81886 gttcaatccctgggtcaggaagatcccctggaggaggatatggcaacccaccccagtgtt 81945 Query: 401 catgcctagagaataccacggacaggggagcctggcgggcta 442 | ||||| |||||| ||| |||||| |||||||||| ||||| Sbjct: 81946 cttgcct-gagaatgccatggacagaggagcctggcaggcta 81986 Score = 65.9 bits (33), Expect = 2e-08 Identities = 54/61 (88%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||| | |||||||| |||||| ||||||||||||| || |||| Sbjct: 52278 tccctgggttgggaagatcctctggagaaggaaatggcaacccactccagtactcttgcc 52337 Query: 407 t 407 | Sbjct: 52338 t 52338 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| || |||| ||||| Sbjct: 77480 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatctcagggacggggga 77539 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 77540 gcctggtgggct 77551 Score = 61.9 bits (31), Expect = 3e-07 Identities = 115/143 (80%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||| | || ||| ||| |||||| | |||| || ||||||||| Sbjct: 47480 tggtaaagaatctgcctgcgaggcaggagacctgggttcgattcctgtgttgggaagatc 47421 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 | | |||||||| |||||| | ||| || ||||||| |||| | |||| ||| ||| || Sbjct: 47420 ctctggagaaggaaatggcaatccattctagtattctcgcctggggaatcccatggatag 47361 Query: 426 gggagcctggcgggctacagtcc 448 || ||||||| ||||| ||||| Sbjct: 47360 aggggcctggcaggctatagtcc 47338 Score = 58.0 bits (29), Expect = 5e-06 Identities = 65/77 (84%) Strand = Plus / Minus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||| |||||| ||||||||||||||| ||||| |||||| ||| || | | ||||| Sbjct: 88568 agaaggcaatggcaccccactccagtattcttgcctggagaatcccatgggcggaggagc 88509 Query: 432 ctggcgggctacagtcc 448 |||| ||||| |||||| Sbjct: 88508 ctggtgggctgcagtcc 88492 >gb|CM000181| Bos taurus chromosome 5-FRAG[42660000,42759999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 137/151 (90%), Gaps = 1/151 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 97309 atggtaaagaatctgcctgcagtgcaggagacctgggttcgatccctgggttgggaagat 97250 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| |||||||||||| ||| |||| Sbjct: 97249 cccctggagaagggaatggctacccactccagtattcttgcctagagaattcca-tgaca 97191 Query: 425 ggggagcctggcgggctacagtccctagggt 455 | |||||||||||||||||||||| |||||| Sbjct: 97190 gaggagcctggcgggctacagtccatagggt 97160 Score = 174 bits (88), Expect = 3e-41 Identities = 139/156 (89%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 27883 tggtaaagaatctgcctgcaatgcaggagacctgggttcaatccctgggtcgggaagatc 27824 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||||| |||||| |||||||||| ||||| ||||| |||||| ||| |||||| Sbjct: 27823 ccctggagaaggaaatggcaacccactccactattcttgcctggagaattccatggacag 27764 Query: 426 gggagcctggcgggctacagtccctagggttgaaaa 461 |||||||||| ||||||||||| | |||||||||| Sbjct: 27763 aggagcctggcaggctacagtccatggggttgaaaa 27728 Score = 139 bits (70), Expect = 2e-30 Identities = 124/142 (87%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 94350 atggtaaagaatctgcctgcaatgcaggagacctgggttcgatccctgggtcgggaagat 94409 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| |||||| || ||||||||||||| | ||| |||||| ||| ||||| Sbjct: 94410 cccctggagaaggaaatggcaacacactccagtattcttacctggagaatcccatggaca 94469 Query: 425 ggggagcctggcgggctacagt 446 | |||||||| |||||||||| Sbjct: 94470 gaggagcctgctgggctacagt 94491 Score = 131 bits (66), Expect = 4e-28 Identities = 129/150 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||| | | ||| |||| |||| |||||||||||| |||||| Sbjct: 2473 tggtaaagaatctgcctgctacacaggagacccacgttcgatccctgggtgggaaagatc 2532 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||||| | |||||| |||||||||||||||| ||||| || ||| |||| ||||| Sbjct: 2533 ccctggagaaagaaatggcaacccactccagtattcttgcctggataatcccacagacag 2592 Query: 426 gggagcctggcgggctacagtccctagggt 455 |||||||||||||||||||||| |||||| Sbjct: 2593 aggagcctggcgggctacagtccatagggt 2622 Score = 119 bits (60), Expect = 2e-24 Identities = 127/148 (85%), Gaps = 1/148 (0%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||| ||||||||||| ||| |||| |||||| ||||| ||||||||||||||| Sbjct: 29086 gtaaagaatatgcctgcaatgtgggagacccaggttcaatcccttggtggggaagatccc 29145 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||| ||||||||||||||| ||||||||| ||||| |||||| | ||||||| | Sbjct: 29146 ctggagaggggaatggctacccatgccagtattcttgcctggagaatcctccggacagag 29205 Query: 428 gagcctggcgggctacagtccctagggt 455 ||| |||| ||||||||||| |||||| Sbjct: 29206 gag-atggcaggctacagtccatagggt 29232 Score = 97.6 bits (49), Expect = 6e-18 Identities = 109/129 (84%) Strand = Plus / Plus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 |||||||||||||| ||| |||| ||||| ||||||||| |||||||||||| |||||| Sbjct: 83458 tctgcctgcaatgcaggagacccaggttcgatccctgggttgggaagatcccctggagaa 83517 Query: 376 gggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 || || ||| |||||||||||||||| | ||| |||||| ||| ||| | ||||||||| Sbjct: 83518 ggaaacggcaacccactccagtattctttcctggagaatcccatggagggaggagcctgg 83577 Query: 436 cgggctaca 444 ||||||| Sbjct: 83578 taggctaca 83586 Score = 89.7 bits (45), Expect = 2e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||| |||| ||||| |||| |||||||| || |||| Sbjct: 19251 tccctgggttgggaagatcccctggaggagggcatggcaacccgctccagtactcttgcc 19192 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaaga 463 | |||||| ||| |||||| |||||||||| || || |||| |||||||| ||||| Sbjct: 19191 tggagaatcccatggacagaggagcctggcaggatatggtccatagggttgcaaaga 19135 Score = 85.7 bits (43), Expect = 2e-14 Identities = 97/115 (84%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||| ||||||||||| ||| ||| ||||| | ||||||| |||||||| ||| Sbjct: 45051 taaagaatccgcctgcaatgcgggagacctgggtttgattcctgggttgggaagatgccc 45110 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||||||||| ||| |||||||||||||||| |||| |||||| ||| |||| Sbjct: 45111 tggagaagggaaaggccacccactccagtattctggcctggagaattccatggac 45165 Score = 83.8 bits (42), Expect = 9e-14 Identities = 96/114 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||| |||| | ||||||| |||||| ||||||| ||||||||| Sbjct: 1827 tggtaaagaatccgcctacaatacaggaaacctgggttcgaaccctgggctgggaagatc 1886 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccac 419 | | ||||||||||| ||||||||||||||||||| |||| |||||| |||| Sbjct: 1887 cactggagaagggaacagctacccactccagtattctggcctggagaattccac 1940 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 74590 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 74649 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 74650 gcctggtgggct 74661 Score = 79.8 bits (40), Expect = 1e-12 Identities = 109/132 (82%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 |||||||| | ||||||| ||||||| ||| |||| || ||||| ||||||| |||| Sbjct: 62284 cgggttcaatacctgggtcaggaagattccctggaggagcacatggcaacccacttcagt 62225 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 |||| ||||| |||||| || |||||| ||||||||| |||||||||||| ||| |||| Sbjct: 62224 attcttgcctggagaatcccgtggacagaggagcctggtgggctacagtccatagcgttg 62165 Query: 458 aaaagagttgga 469 ||| ||||||| Sbjct: 62164 caaacagttgga 62153 Score = 73.8 bits (37), Expect = 9e-11 Identities = 112/137 (81%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| | | |||| ||||||||| || |||||||| Sbjct: 29715 gtaaagaatctgcctgcaatgcaggagatgcaggtttgatccctgggtcggaaagatccc 29774 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||| | || ||||| || |||| |||||||| ||||| |||||| ||| ||| || | Sbjct: 29775 ctggaggaaggcatggcaactcacttcagtattcttgcctggagaatcccatggatagag 29834 Query: 428 gagcctggcgggctaca 444 ||||||| |||||||| Sbjct: 29835 aagcctggagggctaca 29851 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| || |||||| ||||||||||| |||||||| |||||| ||||||||||||| Sbjct: 99324 gggttcaatctctgggtcaggaagatcccctggagaaggaaatggcaacccactccagta 99265 Query: 399 ttcatgcctaga 410 || |||||||| Sbjct: 99264 ctcttgcctaga 99253 Score = 69.9 bits (35), Expect = 1e-09 Identities = 116/143 (81%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| | | |||||| ||||| || ||||||| Sbjct: 95872 tggtaaagaatccacctgcaatgcaggagaagcaggttcaatccctccgtttggaagatt 95931 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||| || ||||| |||||||||||||||| ||||| |||||| || |||||| Sbjct: 95932 ccctggagggggagatggcaacccactccagtattcttgcctggagaatcccttggacag 95991 Query: 426 gggagcctggcgggctacagtcc 448 ||||||| | |||||||||||| Sbjct: 95992 aggagcctagtgggctacagtcc 96014 Score = 69.9 bits (35), Expect = 1e-09 Identities = 93/111 (83%), Gaps = 1/111 (0%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||||| ||||||||| ||||||||||| |||| ||| |||||| |||||||||||| Sbjct: 24952 cgggttcgatccctgggttcggaagatcccctggaggaggaaatggcaacccactccagt 24893 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| ||||| | ||| ||||||| | ||||||||| |||||||||||| Sbjct: 24892 -ttcttgcctgggaaatcccacggatcgaggagcctggtgggctacagtcc 24843 Score = 65.9 bits (33), Expect = 2e-08 Identities = 84/101 (83%) Strand = Plus / Minus Query: 314 aatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggag 373 ||||||||||||| | ||||||| ||||||| ||||||| | ||||||||||| |||| Sbjct: 62079 aatctgcctgcaacacgggaaacctgggttcaatccctggattaggaagatcccctggag 62020 Query: 374 aagggaatggctacccactccagtattcatgcctagagaat 414 | || ||||| || ||||||| ||||| ||||| |||||| Sbjct: 62019 gaaggcatggcaacacactccactattcttgcctggagaat 61979 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 61513 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 61454 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 61453 gcctggtgggct 61442 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 25030 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 25089 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 25090 gcctggtgggct 25101 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||| |||||||| |||||||||||| ||| | | ||||| Sbjct: 5293 ggagaaggaaatggcaacccacttcagtattcttgcctagagaatcccaggaatggggga 5352 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 5353 gcctggtgggct 5364 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 28572 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggtgga 28513 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 28512 gcctggtgggct 28501 Score = 60.0 bits (30), Expect = 1e-06 Identities = 96/118 (81%) Strand = Plus / Minus Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 |||||||||| |||||| ||||||||||||| || ||||| |||||| ||| ||| | Sbjct: 40743 ccggagaaggcaatggcaacccactccagtactcttgcctggagaattccatggatggaa 40684 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||||| |||| ||||| | |||| | | ||||||||| || |||||||||||| Sbjct: 40683 gagcctggtaggctgtagtccatggggtcgcacagagttggacacgactgaagcgact 40626 >gb|CM000180| Bos taurus chromosome 4-FRAG[96750000,96849999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 154/175 (88%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 67543 atggtaaagaatctgcctgcaatgcaggagacctgggttcgatccctgggttgggaagat 67484 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || |||||||||||||||||||||||||||||||| |||| ||||| ||| ||||| Sbjct: 67483 ctcctggagaagggaatggctacccactccagtattctggcctgaagaattccatggaca 67424 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaa 479 | |||||||||| ||||||||||| | |||| | ||||||||||| ||||||||| Sbjct: 67423 gaggagcctggcaggctacagtccatggggtcgcaaagagttggacacaactgaa 67369 Score = 111 bits (56), Expect = 4e-22 Identities = 123/144 (85%), Gaps = 1/144 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| |||||||||||| ||| |||| |||||| ||||||||| |||| || Sbjct: 44936 atggtaaagaatttgcctgcaatgcaggagacccaggttcaatccctgggtcaggaaaat 44995 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| ||||| |||||| |||||||| ||||||||||| ||| || || Sbjct: 44996 ccccttgagaaggg-atggcagcccacttcagtattcttgcctagagaactccatggtca 45054 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||||| |||||||||||| Sbjct: 45055 gaggagcctggtgggctacagtcc 45078 Score = 101 bits (51), Expect = 4e-19 Identities = 137/163 (84%), Gaps = 2/163 (1%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||| |||| ||||||| ||||||||||||| ||| ||||||||||| Sbjct: 46347 gtaaagaatctgcctgtaatgtgggaaacctgggttcagtccctaggttgggaagatccc 46288 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggacagg 426 | |||||| || |||| ||||||||||||||| ||||| |||||| ||| | |||| Sbjct: 46287 ctggagaa-ggcgtggcaacccactccagtatttttgcctggagaatccccatgaacaga 46229 Query: 427 ggagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||||| | |||||||||| | ||| | ||||||||||| Sbjct: 46228 ggagcctggtgagctacagtccatgaggtcgcaaagagttgga 46186 Score = 97.6 bits (49), Expect = 6e-18 Identities = 113/133 (84%), Gaps = 1/133 (0%) Strand = Plus / Plus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 ||||||||||||| |||| ||| |||||| ||||||||| ||||||||||| |||||| Sbjct: 6234 tctgcctgcaatg-tggagacctgggttcgatccctgggtcaggaagatcccctggagaa 6292 Query: 376 gggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 || |||||| ||||||||||||| || ||||| || ||| ||| ||| | ||||||||| Sbjct: 6293 ggaaatggcaacccactccagtactcttgcctggaaaatcccatggatggaggagcctgg 6352 Query: 436 cgggctacagtcc 448 |||||||||||| Sbjct: 6353 tgggctacagtcc 6365 Score = 91.7 bits (46), Expect = 4e-16 Identities = 100/118 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| | |||| ||||||||| |||||||| Sbjct: 46809 tggtaaagaatccgcctgcaatttgggagacctgcgttcgatccctgggttaggaagatc 46750 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 46749 ccctggagaagggaaaggctacccactccagtattctggcctggagaatcccatggac 46692 Score = 89.7 bits (45), Expect = 2e-15 Identities = 81/93 (87%) Strand = Plus / Plus Query: 333 aaacccgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccact 392 ||||| ||||||| ||||||||| |||||||||||| ||||||||||| | ||||||||| Sbjct: 94922 aaacctgggttcaatccctgggttgggaagatcccctggagaagggaaagactacccact 94981 Query: 393 ccagtattcatgcctagagaataccacggacag 425 ||||||| | | ||||||||| ||| |||||| Sbjct: 94982 ccagtatcctggactagagaattccatggacag 95014 Score = 89.7 bits (45), Expect = 2e-15 Identities = 93/109 (85%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| ||||| ||||||||| |||||| || Sbjct: 32572 tggtaaagaatccacctgcaatgtgggagacctgggtttgatccctgggttgggaaggtc 32513 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||| ||||||||||| |||||||||||||||||||| |||| |||||| Sbjct: 32512 ccctggagaagggaaaggctacccactccagtattctggcctggagaat 32464 Score = 85.7 bits (43), Expect = 2e-14 Identities = 82/95 (86%) Strand = Plus / Minus Query: 348 ccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||| |||||||||||| |||| |||| | || |||||||||||||||| ||||| Sbjct: 70269 ccctgggttgggaagatcccctggaggagggcactgcaacccactccagtattcttgcct 70210 Query: 408 agagaataccacggacaggggagcctggcgggcta 442 |||||| ||| |||||| ||||||||| |||||| Sbjct: 70209 ggagaatcccatggacagaggagcctggtgggcta 70175 Score = 83.8 bits (42), Expect = 9e-14 Identities = 117/141 (82%), Gaps = 2/141 (1%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||||||||| | | ||| ||| || || ||||||||| ||||||||||| Sbjct: 19035 aaagaatctgcctgcagttcaggagacctggctttgatccctgggtaaggaagatcccct 18976 Query: 370 ggagaagggaatggctacccact--ccagtattcatgcctagagaataccacggacaggg 427 || |||||||||||||||||||| |||| |||| ||||| |||||| | ||||||| | Sbjct: 18975 ggggaagggaatggctacccactccccagaattcttgcctggagaattcttcggacagag 18916 Query: 428 gagcctggcgggctacagtcc 448 |||| |||| ||||||||||| Sbjct: 18915 gagcttggcaggctacagtcc 18895 Score = 81.8 bits (41), Expect = 4e-13 Identities = 92/109 (84%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 4006 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggagga 4065 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||| ||||||| ||| | |||||| | ||||||||| |||||||| Sbjct: 4066 gcctggtgggctactgtctatggggttgcacagagttggacacaactga 4114 Score = 79.8 bits (40), Expect = 1e-12 Identities = 58/64 (90%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 ||||||||||||||| |||||||||||||| |||| ||| |||||||||||| |||||| Sbjct: 62835 cgggttcagtccctgagtggggaagatcccttggaggaggaaatggctacccattccagt 62776 Query: 398 attc 401 |||| Sbjct: 62775 attc 62772 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 61451 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 61392 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 61391 gcctggtgggct 61380 Score = 77.8 bits (39), Expect = 6e-12 Identities = 105/127 (82%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||| |||||||||||||||||| ||| || | ||||| || |||||| | ||||| Sbjct: 57012 atggtagagaatctgcctgcaatgcaggagacttgagttcaatctctgggttgcaaagat 57071 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||| |||||| ||| |||||||| ||| ||||| |||||| ||| ||||| Sbjct: 57072 cccctagagaaggaaatggcaaccaactccagttttcttgcctggagaattccatggaca 57131 Query: 425 ggggagc 431 | ||||| Sbjct: 57132 gaggagc 57138 Score = 73.8 bits (37), Expect = 9e-11 Identities = 86/101 (85%), Gaps = 1/101 (0%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||| ||||| ||||| ||| || |||||| |||||| ||| |||||||||| Sbjct: 60443 gtaaagaatcaacctgccaatgcaggagacacgggtttggtcccttggttgggaagatcc 60384 Query: 367 cccggagaagggaatggctacccactccagtattcatgcct 407 || |||| ||| |||||| |||||||||||||||| ||||| Sbjct: 60383 cctggaggaggaaatggcaacccactccagtattcttgcct 60343 Score = 73.8 bits (37), Expect = 9e-11 Identities = 73/85 (85%) Strand = Plus / Minus Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| ||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||| Sbjct: 95770 tcccctggagaagaaaatggcaacccactccagtattcttgcctggagaatcccatggac 95711 Query: 424 aggggagcctggcgggctacagtcc 448 || || ||||| |||||||||||| Sbjct: 95710 agaggcacctggtgggctacagtcc 95686 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 21283 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 21342 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 21343 gcctggtgggct 21354 Score = 69.9 bits (35), Expect = 1e-09 Identities = 68/79 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| || ||||| || ||| ||| |||||||||| Sbjct: 61594 ggagaaggcaatggcaccccactccagtactcttgcctggaaaatcccatggacagggga 61535 Query: 430 gcctggcgggctacagtcc 448 |||||| ||||| |||||| Sbjct: 61534 gcctggtgggctgcagtcc 61516 Score = 69.9 bits (35), Expect = 1e-09 Identities = 68/79 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| |||| ||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 52146 ggaggagggcatggcaacccactccagtattcttgcctggagaatcccatggacagagga 52087 Query: 430 gcctggcgggctacagtcc 448 ||||| ||||| |||||| Sbjct: 52086 gcctgatgggctgcagtcc 52068 Score = 67.9 bits (34), Expect = 6e-09 Identities = 85/102 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||| ||| ||||||| |||| |||||||| |||||| |||||||| ||||| | |||| Sbjct: 14919 tcccttggttgggaagaccccctggagaaggaaatggcaacccactctagtatccttgcc 14978 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| ||||| |||||||||| ||||||||||| Sbjct: 14979 tgggaaatcccatagacagaggagcctggcaggctacagtcc 15020 Score = 65.9 bits (33), Expect = 2e-08 Identities = 111/137 (81%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||||| |||| || ||| ||||| ||||||||| |||||| Sbjct: 40114 atggtaaagaatctgcctgcgatgcaagaggcccaggttccatccctgggtccagaagat 40055 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||| | | |||| |||||||||||| ||| ||||| |||||| ||| ||||| Sbjct: 40054 cccctagagagagcactggcaacccactccagtgttcctgcctggagaatcccatggaca 39995 Query: 425 ggggagcctggcgggct 441 | | |||||||| |||| Sbjct: 39994 gagaagcctggcaggct 39978 Score = 63.9 bits (32), Expect = 9e-08 Identities = 116/144 (80%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| |||||| |||| ||| |||| ||| ||||||||| ||||||| Sbjct: 20876 atggtaaagaatatgcctgtaatgagggagacccaggtatgatccctgggtcaggaagat 20817 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||| ||||||||| ||| || ||||||||| ||||| | ||| ||| ||||| Sbjct: 20816 tccctggaggagggaatggttacgcattccagtattattgcctgggaaatcccatggaca 20757 Query: 425 ggggagcctggcgggctacagtcc 448 | |||||||||| |||||||||| Sbjct: 20756 gaggagcctggcaagctacagtcc 20733 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| || ||| ||| |||||| ||| Sbjct: 94538 ggagaaggaaatggcaacccactccagtgttcttgcctggaaaatcccagggacagagga 94597 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 94598 gcctggtgggct 94609 Score = 61.9 bits (31), Expect = 3e-07 Identities = 62/71 (87%), Gaps = 1/71 (1%) Strand = Plus / Minus Query: 388 ccactccagtattcatgcctagagaatacc-acggacaggggagcctggcgggctacagt 446 |||||||||| ||| ||||| |||||| || | |||||| |||||||||| ||||||||| Sbjct: 8737 ccactccagtcttcctgcctggagaatccccatggacagaggagcctggcaggctacagt 8678 Query: 447 ccctagggttg 457 || |||||||| Sbjct: 8677 ccatagggttg 8667 Score = 61.9 bits (31), Expect = 3e-07 Identities = 88/107 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||| |||| ||||| |||||||||||| || |||| Sbjct: 77400 tccctgggtcaggaagatcccctggaggagggcatggcaacccactccagtgctcttgcc 77341 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagg 453 | ||| || || |||||| ||||| ||| |||||| ||||||||| Sbjct: 77340 ttgagcatctcatggacagaggagcttggggggctatggtccctagg 77294 Score = 61.9 bits (31), Expect = 3e-07 Identities = 67/79 (84%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||| |||||||| || |||||||| ||| ||| ||| | ||| Sbjct: 79607 ggagaaggaaatggcaaccccctccagtactcttgcctagaaaattccatggatggagga 79666 Query: 430 gcctggcgggctacagtcc 448 |||||| |||||||||||| Sbjct: 79667 gcctggtgggctacagtcc 79685 Score = 61.9 bits (31), Expect = 3e-07 Identities = 55/63 (87%) Strand = Plus / Minus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||||||||| || Sbjct: 60661 aatggcaacccactccagtgttcttgcctggagaatcccagggacgggggagcctggtgg 60602 Query: 439 gct 441 ||| Sbjct: 60601 gct 60599 Score = 60.0 bits (30), Expect = 1e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 ||||| |||||||||| ||||||||||| |||| |||| ||||| |||||||||| ||| Sbjct: 47672 ggttcggtccctgggtcaggaagatcccctggaggagggcatggcaacccactccaatat 47613 Query: 400 tc 401 || Sbjct: 47612 tc 47611 Score = 58.0 bits (29), Expect = 5e-06 Identities = 56/65 (86%) Strand = Plus / Minus Query: 381 tggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgggc 440 |||| |||||||||||||||| |||| | ||| ||| |||||| |||||||||||||| Sbjct: 17730 tggcaacccactccagtattcttgcccgggaaatcccatggacagaggagcctggcgggc 17671 Query: 441 tacag 445 ||||| Sbjct: 17670 tacag 17666 Score = 58.0 bits (29), Expect = 5e-06 Identities = 62/73 (84%) Strand = Plus / Minus Query: 335 acccgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactcc 394 |||| |||||| ||||||||| |||||||| || || ||||| |||||| || |||||| Sbjct: 3367 acccaggttcaatccctgggtcgggaagatatcctggggaaggaaatggcaactcactcc 3308 Query: 395 agtattcatgcct 407 ||||||| ||||| Sbjct: 3307 agtattcttgcct 3295 >gb|CM000180| Bos taurus chromosome 4-FRAG[14580000,14679999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 136/151 (90%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||||||||||||||| ||| ||||||||||| | ||||||| |||||||||| Sbjct: 82285 ggtaaagaatctgcctgcaatgcaggagacccgggttcaatgcctgggttgggaagatcc 82344 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||||||||||||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 82345 cctggagaagggaatggcaacccactccagtattcttgcctggagaattccatggacaga 82404 Query: 427 ggagcctggcgggctacagtccctagggttg 457 ||||| |||||||||||||||| | |||||| Sbjct: 82405 ggagcatggcgggctacagtccatggggttg 82435 Score = 151 bits (76), Expect = 5e-34 Identities = 115/128 (89%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| || |||| |||||||||||||||| |||||||| Sbjct: 70223 atggtaaagaatctgcctgcaatgcgagagacccaggttcagtccctgggtcgggaagat 70164 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || |||||||||||| |||||||||||||| |||| ||||| |||||| ||||||||| Sbjct: 70163 ctcctggagaagggaatagctacccactccagaattcttgcctggagaattccacggaca 70104 Query: 425 ggggagcc 432 | |||||| Sbjct: 70103 gaggagcc 70096 Score = 113 bits (57), Expect = 1e-22 Identities = 120/141 (85%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||||||||| ||| || ||||||| | ||||||| |||||||||| Sbjct: 21449 gtaaagaatctgcctgcaatgtaggagactcgggttcgattcctgggtcaggaagatccc 21390 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| | |||||||||||||| ||||| ||||| || |||||| | Sbjct: 21389 ctggagaaggaaatggcaatccactccagtattcttgcctgaagaatttcatggacagag 21330 Query: 428 gagcctggcgggctacagtcc 448 |||||||| |||||||||||| Sbjct: 21329 gagcctggtgggctacagtcc 21309 Score = 111 bits (56), Expect = 4e-22 Identities = 123/144 (85%), Gaps = 1/144 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| ||||||||| ||||| ||| ||| |||||| |||||||| |||||||| Sbjct: 25320 atggtaaagtatctgcctgtaatgcaggagacctgggttcgacccctgggttgggaagat 25379 Query: 365 ccccc-ggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 |||| |||||||| || ||| |||||||||||||||| ||||| | |||| ||| |||| Sbjct: 25380 tcccctggagaaggaaacggcaacccactccagtattcttgcctggggaattccatggac 25439 Query: 424 aggggagcctggcgggctacagtc 447 || ||||||||| ||||||||||| Sbjct: 25440 agaggagcctggagggctacagtc 25463 Score = 99.6 bits (50), Expect = 2e-18 Identities = 131/158 (82%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||| |||||||| ||| ||| ||||| ||||||||| ||||||||||| Sbjct: 87580 gtaaagaatctgtctgcaatgtgggagacctgggtttgatccctgggttgggaagatccc 87521 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||| ||| ||||| |||||||||| ||||| | ||| |||| | ||| ||| || | Sbjct: 87520 ctggagcaggtcatggcaacccactccactattcttacctggagactcccatggatagag 87461 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagt 465 ||||||||||||||||||||| | |||| | ||||||| Sbjct: 87460 gagcctggcgggctacagtccatggggtcgcaaagagt 87423 Score = 97.6 bits (49), Expect = 6e-18 Identities = 88/101 (87%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||||| |||| |||| ||||| |||||||||||||||| ||||| |||||| | Sbjct: 490 gggaagatcccctggaggagggcatggcaacccactccagtattcttgcctggagaatcc 431 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttg 457 || |||||| ||||||||| ||||||||||| | |||||| Sbjct: 430 catggacagaggagcctggtaggctacagtccatggggttg 390 Score = 95.6 bits (48), Expect = 2e-17 Identities = 121/144 (84%), Gaps = 1/144 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||| ||||||||||||||||| ||| ||| | |||| | |||| || |||||||| Sbjct: 24948 atggtaaggaatctgcctgcaatgcgggagacctgagttcgatacctgagttgggaagat 24889 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggac 423 |||| |||| || ||||| |||||||| ||||||| |||||||||||| ||| |||| Sbjct: 24888 cccctggaggccggcatggcaacccactctagtattcttgcctagagaatccccagggac 24829 Query: 424 aggggagcctggcgggctacagtc 447 || |||||||||| |||||||||| Sbjct: 24828 agaggagcctggcaggctacagtc 24805 Score = 95.6 bits (48), Expect = 2e-17 Identities = 121/144 (84%), Gaps = 1/144 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||| || ||| ||| ||| ||||| | ||| ||||| ||||||||| Sbjct: 80822 tggtaaagaatccgcctacagtgcaggagacctgggtttaatccttgggttgggaagatc 80763 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggaca 424 ||| |||| |||| ||||| |||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 80762 ccctggaggagggcatggcaacccactccagtattcttgcctggagaatccccatggaca 80703 Query: 425 ggggagcctggcgggctacagtcc 448 | ||| ||||| ||||||||||| Sbjct: 80702 gaggaacctggtaggctacagtcc 80679 Score = 89.7 bits (45), Expect = 2e-15 Identities = 112/134 (83%), Gaps = 4/134 (2%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || |||||||||||| |||| |||| ||||| ||||| |||||||||| |||| Sbjct: 79855 tccctgtgttgggaagatcccctggaggagggcatggcgacccagtccagtattcttgcc 79796 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| |||||||| | |||| |||||| |||| |||||||| Sbjct: 79795 tggagaatcccatggacagaggagcctgacaggctgcagtcc----agttgcaaagagtt 79740 Query: 467 ggatacaactgaag 480 ||| |||||||||| Sbjct: 79739 ggacacaactgaag 79726 Score = 89.7 bits (45), Expect = 2e-15 Identities = 90/105 (85%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||||||||||||| ||| ||| ||||| | ||||||| ||||||||||| Sbjct: 95842 aaagaatctgcctgcaatgcaggagacctgggtttgattcctgggtcaggaagatcccct 95783 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||||||||| |||||||||||||||| || || |||||| Sbjct: 95782 agagaagggaatggcaacccactccagtattcttggctggagaat 95738 Score = 81.8 bits (41), Expect = 4e-13 Identities = 86/101 (85%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||| |||||||||||||| ||| ||| |||||| |||||||| ||||||||| Sbjct: 60508 ggtaaagtgtctgcctgcaatgcaggagacctgggttcgacccctgggtcaggaagatcc 60567 Query: 367 cccggagaagggaatggctacccactccagtattcatgcct 407 || |||||||| |||||| ||||||||||||| || ||||| Sbjct: 60568 cctggagaaggaaatggcaacccactccagtactcttgcct 60608 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||| ||| Sbjct: 59161 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagagga 59220 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | || | |||||| | ||||||||| || |||||||||||| Sbjct: 59221 gcctggtgggctgccatcaatggggttgcacagagttggacacgactgaagcgact 59276 Score = 77.8 bits (39), Expect = 6e-12 Identities = 69/79 (87%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||| ||||||| ||||||||||||||| ||||||||||||| || ||||| |||||| | Sbjct: 43985 gggacgatcccctggagaagggaatggcaacccactccagtactcttgcctggagaatcc 44044 Query: 417 cacggacaggggagcctgg 435 ||| || || ||||||||| Sbjct: 44045 cactgatagaggagcctgg 44063 Score = 73.8 bits (37), Expect = 9e-11 Identities = 112/137 (81%) Strand = Plus / Plus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| ||||||||| | |||| ||| || ||| ||||||||||||| || Sbjct: 75538 ttcaatccctgggttgggaagatcttctggaggaggaaacggcaacccactccagtactc 75597 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaa 461 ||||| | ||| ||| |||||| ||||||||||| |||||||||| | |||| || || Sbjct: 75598 ttgcctgggaaatcccatggacagaggagcctggcgagctacagtccatggggtcgagaa 75657 Query: 462 gagttggatacaactga 478 |||| ||| || ||||| Sbjct: 75658 gagtcggacaccactga 75674 Score = 73.8 bits (37), Expect = 9e-11 Identities = 58/65 (89%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| |||||||||||| || |||||| ||| Sbjct: 59034 ggagaaggaaatggcaacccactccagtattcttgcctagagaattccctggacagagga 59093 Query: 430 gcctg 434 ||||| Sbjct: 59094 gcctg 59098 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 67595 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatgccagggacggggga 67654 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 67655 gcctggtgggct 67666 Score = 71.9 bits (36), Expect = 4e-10 Identities = 92/108 (85%), Gaps = 2/108 (1%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| |||||||||||||| ||||||| |||||||| |||||| ||||||||||||| | Sbjct: 25154 gttcaatccctgggtgggga-gatcccctggagaaggaaatggcaacccactccagtact 25212 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 | ||||| | ||| ||| | |||| ||||||| || ||||||||||| Sbjct: 25213 cttgcctgggaaatcccatgaacagaggagcct-gcaggctacagtcc 25259 Score = 69.9 bits (35), Expect = 1e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 |||||||||||||||| ||||| || ||| ||| |||||| ||||||| ||||||||||| Sbjct: 69151 acccactccagtattcttgcctggaaaatcccatggacagaggagcctagcgggctacag 69092 Query: 446 tcc 448 ||| Sbjct: 69091 tcc 69089 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 56081 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 56140 Query: 430 gcctgg 435 |||||| Sbjct: 56141 gcctgg 56146 Score = 67.9 bits (34), Expect = 6e-09 Identities = 73/86 (84%) Strand = Plus / Minus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||||| |||||||||||||||| ||||| |||||| || |||||| ||||||||||| Sbjct: 18908 aatggcaacccactccagtattcttgcctggagaatcccttggacagaagagcctggcgg 18849 Query: 439 gctacagtccctagggttgaaaagag 464 || ||||| |||||||| |||||| Sbjct: 18848 gcccaagtccgtagggttgcaaagag 18823 Score = 65.9 bits (33), Expect = 2e-08 Identities = 97/117 (82%), Gaps = 1/117 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||||||||| ||||| ||| |||| ||||| ||||||||| | |||||| Sbjct: 72398 ggtaaagaatctgcctataatgcaggagacccaggttccatccctgggttgcaaagatcg 72457 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 || ||| ||||||||| ||| || ||||||||||| ||||| |||||| ||| |||| Sbjct: 72458 cctggaaaagggaatgacta-ccgctccagtattcttgcctggagaatcccatggac 72513 Score = 61.9 bits (31), Expect = 3e-07 Identities = 61/71 (85%) Strand = Plus / Plus Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| | |||| |||||||||||| ||| ||||| |||||| ||| |||| |||||| Sbjct: 34095 gagaaggaagtggcaacccactccagtgttcttgcctggagaatcccagggacgggggag 34154 Query: 431 cctggcgggct 441 ||||| ||||| Sbjct: 34155 cctggtgggct 34165 Score = 60.0 bits (30), Expect = 1e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 381 tggctacccactccagtattcatgcctagagaat 414 ||||||||||||||||||||||||||| |||||| Sbjct: 53454 tggctacccactccagtattcatgcctggagaat 53421 >gb|CM000178| Bos taurus chromosome 2-FRAG[62910000,63009999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 170/195 (87%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||| |||||| ||||||||| ||| ||| ||||||| ||||||||| ||||||| Sbjct: 34532 atggtaatgaatctacctgcaatgtgggagacctgggttcaatccctgggtcaggaagat 34591 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||| |||||||||||||||| ||||| |||| ||||| |||||| ||| ||||| Sbjct: 34592 cccctggagcagggaatggctacccattccagcattcctgcctggagaattccatggaca 34651 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | | |||||||||||||||||||| | |||||| |||||||||| |||||||| |||||| Sbjct: 34652 gagaagcctggcgggctacagtccatggggttgcaaagagttggctacaactg-agcgac 34710 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 34711 taacactttcacttt 34725 Score = 121 bits (61), Expect = 4e-25 Identities = 139/165 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||| | ||||||||||||| ||| |||| |||||| ||||||||| ||||||| Sbjct: 28069 atggtaaaaagtctgcctgcaatgtgggagacccaggttcaatccctgggtcaggaagat 28128 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| || |||||||||||| |||||||||||||||| ||||| |||||| | ||||| Sbjct: 28129 cccctggggaagggaatggcaacccactccagtattcttgcctggagaatcacttggaca 28188 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | ||||||| || |||| |||||| | |||||| || |||||||| Sbjct: 28189 gaggagcctagcaggcttcagtccatggggttgtaaggagttgga 28233 Score = 105 bits (53), Expect = 3e-20 Identities = 117/139 (84%), Gaps = 7/139 (5%) Strand = Plus / Plus Query: 304 aatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaaga 363 ||||||||||||| |||||||||||| ||| ||||| |||||| || || |||| Sbjct: 74320 aatggtaaagaatttgcctgcaatgcagga-------gttcaatccctgtgttggaaaga 74372 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||||||||||||||| |||||||||||||||||||| ||||| || ||| | | |||| Sbjct: 74373 tcccccggagaagggaaaggctacccactccagtattcttgcctggacaatcctatggac 74432 Query: 424 aggggagcctggcgggcta 442 || |||||||||| ||||| Sbjct: 74433 agaggagcctggcaggcta 74451 Score = 95.6 bits (48), Expect = 2e-17 Identities = 78/88 (88%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||| Sbjct: 14868 tccctgggtcaggaagatcccctggagaagggaatggctacccactccagtattcttgcc 14809 Query: 407 tagagaataccacggacaggggagcctg 434 | || ||| ||| || ||| |||||||| Sbjct: 14808 tggaaaattccatggtcagaggagcctg 14781 Score = 91.7 bits (46), Expect = 4e-16 Identities = 118/142 (83%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||||||||||||| || ||| |||||||| | ||||||| ||||||||| Sbjct: 82040 ggtaaagaatctgcctgcaaggcaggagctgcgggttcaatacctgggtcaggaagatcc 82099 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||| |||| ||||| |||||||||||||||| ||||| |||||| || |||||| Sbjct: 82100 cctggaggagggcatggcaacccactccagtattcttgcctggagaatttcatggacaga 82159 Query: 427 ggagcctggcgggctacagtcc 448 | || || || ||||||||||| Sbjct: 82160 gaagtctagcaggctacagtcc 82181 Score = 85.7 bits (43), Expect = 2e-14 Identities = 113/135 (83%), Gaps = 1/135 (0%) Strand = Plus / Plus Query: 314 aatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggag 373 ||||||||||||||| ||| |||| |||||| ||||||||| |||||||||| || | Sbjct: 7477 aatctgcctgcaatgtgggagacccaggttcaatccctgggtcaggaagatcccttgggg 7536 Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 ||| ||||||| ||||| |||||||||| || || ||||| | |||||| ||||||| Sbjct: 7537 aagtgaatggcaacccattccagtattcttg-ctgaagaatcacttggacagaggagcct 7595 Query: 434 ggcgggctacagtcc 448 ||||||||||||||| Sbjct: 7596 ggcgggctacagtcc 7610 Score = 81.8 bits (41), Expect = 4e-13 Identities = 68/77 (88%) Strand = Plus / Plus Query: 387 cccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagt 446 ||||||||||||||| ||||| |||||| |||| ||||| |||||||||| || |||||| Sbjct: 36741 cccactccagtattcttgcctggagaatcccacagacagaggagcctggcaggttacagt 36800 Query: 447 ccctagggttgaaaaga 463 || |||||||| ||||| Sbjct: 36801 ccatagggttgcaaaga 36817 Score = 79.8 bits (40), Expect = 1e-12 Identities = 115/140 (82%) Strand = Plus / Plus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| |||||||| ||| |||| |||| |||| |||||||||||||||| Sbjct: 50944 ttcaatccctgggttgggaagattccctggaggagggcatggaaacccactccagtattc 51003 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaa 461 | ||| |||||| | |||||| ||| ||||| |||||| ||||| ||||||| ||| Sbjct: 51004 tttcctggagaatctcttggacagaggaacctggggggctatagtccatagggtttcaaa 51063 Query: 462 gagttggatacaactgaagc 481 |||| ||| || |||||||| Sbjct: 51064 gagtcggacacgactgaagc 51083 Score = 79.8 bits (40), Expect = 1e-12 Identities = 107/128 (83%), Gaps = 1/128 (0%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| |||| |||| ||| |||||| ||||| ||||| |||||| || Sbjct: 63008 ggaagatcccctggaggagggcatgga-acctactccaatattcttgcctggagaatccc 62950 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactg 477 | |||||| |||||||||| | || |||||| | |||| | | ||||||||| ||||||| Sbjct: 62949 atggacagaggagcctggcagactgcagtccatggggtcgcacagagttggacacaactg 62890 Query: 478 aagcgact 485 |||||||| Sbjct: 62889 aagcgact 62882 Score = 75.8 bits (38), Expect = 2e-11 Identities = 87/102 (85%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | |||| ||||||| ||||||||||||||| ||| |||| ||||||| |||| Sbjct: 67248 tccctggatagggaggatcccctggagaagggaatggcaacctactcgagtattcttgcc 67307 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| |||||| ||||||||| |||||||||||| Sbjct: 67308 t-gggaaatccatggacagaggagcctggtgggctacagtcc 67348 Score = 71.9 bits (36), Expect = 4e-10 Identities = 96/116 (82%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 9100 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 9159 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| ||| || |||||| | ||||||||| || ||||||| |||| Sbjct: 9160 gcctggtgggctgttgtctctggggttgcacagagttggacacgactgaagtgact 9215 Score = 69.9 bits (35), Expect = 1e-09 Identities = 80/95 (84%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||| ||||| || | | ||| |||| | |||| ||||||||| | |||||| Sbjct: 73141 ggtaaagaatatgcctacattacaggagacccagcttcaatccctgggtcagaaagatct 73200 Query: 367 cccggagaagggaatggctacccactccagtattc 401 || |||||| ||||||||||||||||||||||||| Sbjct: 73201 cctggagaaaggaatggctacccactccagtattc 73235 Score = 63.9 bits (32), Expect = 9e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| ||| ||||| Sbjct: 6116 ggagaaggaaatggcaacccactccagtattcttgcctggagaatgccagggatggggga 6175 Query: 430 gcct 433 |||| Sbjct: 6176 gcct 6179 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||| | ||| |||| ||| | Sbjct: 60953 ggagaaggaaatggcaacccactccagtattcttgcctggagagtcccagggacggggaa 61012 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 61013 gcctggtgggct 61024 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||| | Sbjct: 80167 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccaaggacggggaa 80226 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 80227 gcctggtgggct 80238 Score = 63.9 bits (32), Expect = 9e-08 Identities = 90/108 (83%), Gaps = 1/108 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaaccc-gggttcagtccctgggtggggaagat 364 |||||||||||||||||||| || ||| || | ||||| ||||||||| ||||||| Sbjct: 55696 tggtaaagaatctgcctgcagtgtgggagactctgggtttcatccctgggttgggaagac 55755 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagaga 412 |||| |||| |||| ||||| ||||||||||| |||| ||||| |||| Sbjct: 55756 cccctggaggagggcatggcaacccactccagaattcttgcctggaga 55803 Score = 60.0 bits (30), Expect = 1e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||| |||||| || ||||||||||||| |||||||||||| Sbjct: 16958 cggagaaggaaatggcaacgcactccagtattcttgcctagagaat 17003 Score = 58.0 bits (29), Expect = 5e-06 Identities = 63/73 (86%), Gaps = 1/73 (1%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| | ||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 51134 ggagaaggaaatggcaatgcactccagtattc-tgcctggagaatcccatggacagagga 51192 Query: 430 gcctggcgggcta 442 |||| |||||||| Sbjct: 51193 gcctagcgggcta 51205 >gb|CM000195| Bos taurus chromosome 19-FRAG[8280000,8379999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 170/195 (87%), Gaps = 1/195 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||| Sbjct: 85210 atggtaaagaatctgcctgcaatgcaggaaacccgggttcaatccctgggttgggaagat 85151 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || ||||||||||||||||||||||| |||||||| |||| ||| || ||| ||||| Sbjct: 85150 ctcctggagaagggaatggctacccactgcagtattcttgccaggagcattccatggaca 85091 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | |||||||||| ||||||||||| | |||| |||||||||| | |||| |||||| Sbjct: 85090 gaggagcctggcaggctacagtccatgcagttgccaagagttggacatgactg-agcgac 85032 Query: 485 tcacactttcacttt 499 | ||||||||||||| Sbjct: 85031 taacactttcacttt 85017 Score = 95.6 bits (48), Expect = 2e-17 Identities = 87/100 (87%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||| ||||||||| ||| |||| |||||| ||||||||| |||||||| | Sbjct: 70304 gtaaagaatcttcctgcaatgaaggagacccaggttcaatccctgggtcaggaagatctc 70245 Query: 368 ccggagaagggaatggctacccactccagtattcatgcct 407 ||||||| |||||||||||||||||||||||| ||||| Sbjct: 70244 ttggagaagagaatggctacccactccagtattcttgcct 70205 Score = 91.7 bits (46), Expect = 4e-16 Identities = 100/118 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||||||| ||| ||| |||||| |||| ||| ||||||||| Sbjct: 10289 tggtaaagaatctgcctgcaatgtgggagacctgggttcgaccccttggttgggaagatc 10230 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| ||||| |||||||| ||||| |||| |||||| ||| |||| Sbjct: 10229 ccctggagaagggaaaggctatccactccaatattctggcctggagaattccatggac 10172 Score = 87.7 bits (44), Expect = 6e-15 Identities = 120/144 (83%), Gaps = 1/144 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||| |||||||||||| ||||| ||| || | |||||| ||| |||| |||||||| Sbjct: 74100 tggtaacgaatctgcctgccaatgcaggagacgcaggttcaatccgcgggtcgggaagat 74159 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||| ||| |||||| ||| |||||||||||| ||||| ||||| ||| ||||| Sbjct: 74160 cccctggaggaggaaatggcaaccgactccagtattcttgcctggagaagcccatggaca 74219 Query: 425 ggggagcctggcgggctacagtcc 448 | | ||||||||||| | |||||| Sbjct: 74220 gagaagcctggcggggtgcagtcc 74243 Score = 85.7 bits (43), Expect = 2e-14 Identities = 70/79 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||||||||||||||||||||||||||| ||||| ||| | ||| |||||| ||| Sbjct: 70340 ggagaagggaatggctacccactccagtattcttgcctggagtactccatggacagagga 70399 Query: 430 gcctggcgggctacagtcc 448 ||||| |||||||||||| Sbjct: 70400 gcctgaagggctacagtcc 70418 Score = 79.8 bits (40), Expect = 1e-12 Identities = 88/104 (84%) Strand = Plus / Plus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| |||| |||| ||||| |||||||||||||||| ||| | ||||| ||| || Sbjct: 18526 gatcccctggaggagggcatggcaacccactccagtattcttgcttgaagaatcccatgg 18585 Query: 422 acaggggagcctggcgggctacagtccctagggttgaaaagagt 465 |||| |||||||||| |||||||||| | |||||| ||||||| Sbjct: 18586 acagaggagcctggcaggctacagtctatggggttgcaaagagt 18629 Score = 79.8 bits (40), Expect = 1e-12 Identities = 85/100 (85%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| |||| ||| |||||| ||||||||||| |||||| | || Sbjct: 32558 cctgggtcaggaagatcccctggagtaggaaatggcaacccactccaggattcatactta 32617 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 || ||| |||||| ||| ||||| || ||||||||||||| Sbjct: 32618 gaaaattccacgggcagaggagcttgacgggctacagtcc 32657 Score = 79.8 bits (40), Expect = 1e-12 Identities = 109/132 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| | ||||||||| | || |||| Sbjct: 82030 tccctgggttgggaagatcccttggagaaggaaatggcaatccactccagcactcttgcc 81971 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | || ||| ||| |||||| ||||||| | ||||||||||| | |||||| ||||||| Sbjct: 81970 tggaaaatcccatggacagaggagcctagtaggctacagtccatggggttgcaaagagtc 81911 Query: 467 ggatacaactga 478 ||| || ||||| Sbjct: 81910 ggacacgactga 81899 Score = 77.8 bits (39), Expect = 6e-12 Identities = 119/143 (83%), Gaps = 2/143 (1%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||| ||||||| |||| |||||| || |||||| |||||||||| Sbjct: 46893 gtaaagaatctgcctgcagtgctggagacccaggttcaatctctgggtcaggaagatccc 46834 Query: 368 ccggagaagggaatggc-tacccactccagtattcatgcctagagaataccacggac-ag 425 | ||||| |||||| |||||| |||||||| | ||||| || ||| ||| |||| || Sbjct: 46833 gtgaggaaggaaatggcttacccattccagtatccttgcctggaaaattccatggacaag 46774 Query: 426 gggagcctggcgggctacagtcc 448 |||||||| |||||||||||| Sbjct: 46773 aggagcctgaagggctacagtcc 46751 Score = 75.8 bits (38), Expect = 2e-11 Identities = 89/106 (83%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||| |||||||| | ||| |||| | || ||||||||| |||| ||||| Sbjct: 15381 gtaaagaatctacctgcaatacaggagacccagattggatccctgggtcaggaaaatccc 15440 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaa 413 | |||||||||| |||| |||||||||||||||| ||||| ||||| Sbjct: 15441 ctggagaagggagtggcaacccactccagtattcttgcctggagaa 15486 Score = 75.8 bits (38), Expect = 2e-11 Identities = 80/94 (85%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||| ||||| |||||| | ||||| ||||||||| ||||||||||| Sbjct: 96349 gtaaagaatctgcctataatgcaggaaacacaggttcgatccctgggtcgggaagatccc 96408 Query: 368 ccggagaagggaatggctacccactccagtattc 401 | |||| ||| ||||| | |||||||||||||| Sbjct: 96409 ctggagcaggcgatggcaatccactccagtattc 96442 Score = 75.8 bits (38), Expect = 2e-11 Identities = 104/126 (82%) Strand = Plus / Minus Query: 311 aagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccg 370 |||||| |||||||||||| ||| | ||||||| ||| ||||| ||||||||||| | Sbjct: 73724 aagaatttgcctgcaatgcaggaggcttgggttcaatccttgggtcaggaagatcccctg 73665 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||| | |||||||| ||||| |||||||| ||||| |||||| || ||||| |||| Sbjct: 73664 gagaatgaaatggctatccactgcagtattcttgcctggagaattccggggacataggag 73605 Query: 431 cctggc 436 |||||| Sbjct: 73604 cctggc 73599 Score = 71.9 bits (36), Expect = 4e-10 Identities = 87/104 (83%) Strand = Plus / Minus Query: 311 aagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccg 370 ||||||| ||||||||| ||||||| |||||| |||||||| | |||||||||| | Sbjct: 29801 aagaatccacctgcaatgtgggaaacctgggttcgacccctgggttgagaagatcccctg 29742 Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||| |||||||| ||||||||||| |||| |||||| Sbjct: 29741 gagaagggaccggctacccgctccagtattctggcctggagaat 29698 Score = 69.9 bits (35), Expect = 1e-09 Identities = 95/115 (82%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| ||||||||||| ||||||| ||||| ||||| |||||| Sbjct: 78528 gggttcaatccctgggttaggaagatcccctggagaagaaaatggtatcccaccccagta 78587 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagg 453 ||| ||||| | ||| ||| |||||| |||| |||| || |||||||||||||| Sbjct: 78588 ttcttgcctgggaaatcccatggacagaggaggctggtggactacagtccctagg 78642 Score = 65.9 bits (33), Expect = 2e-08 Identities = 66/77 (85%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||||| ||||||| |||||| |||||||||||||||| ||||| | ||| | Sbjct: 98176 gggaagatcccctagagaaggaaatggcaacccactccagtattcttgcctgggaaatcc 98235 Query: 417 cacggacaggggagcct 433 || |||||| ||||||| Sbjct: 98236 catggacagaggagcct 98252 Score = 65.9 bits (33), Expect = 2e-08 Identities = 78/93 (83%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||||||| ||| | || ||||| | ||||||| ||||||||| | Sbjct: 10405 taaagaatctgcctgcaatgcaggagatcctggttcgattcctgggtcaggaagatccgc 10346 Query: 369 cggagaagggaatggctacccactccagtattc 401 |||||||| | ||||||||| |||||||||| Sbjct: 10345 tggagaaggcataggctacccattccagtattc 10313 Score = 65.9 bits (33), Expect = 2e-08 Identities = 129/161 (80%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| || |||| |||| |||| || ||||| Sbjct: 86868 atggtaaagaatctgcctgcagtgcaggagtgccaggtttgatcccggggttggaaagat 86809 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| | |||| |||||||| |||||| || |||| ||||| |||||| ||| ||| | Sbjct: 86808 cccctgaagaaaggaatggcagcccacttcaatattattgcctggagaatgccatggaga 86749 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||||||||| ||||| ||||| | |||||| ||||||| Sbjct: 86748 gaggagcctggtgggctgcagtcgatggggttgtaaagagt 86708 Score = 63.9 bits (32), Expect = 9e-08 Identities = 112/138 (81%), Gaps = 3/138 (2%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||||||| ||| ||| || ||| || |||||| |||| ||| Sbjct: 51039 taaagaatctgcctgcaatgcaggagacctggattcgatctctgggtctggaat---ccc 51095 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 | |||||||| ||||||||| |||||||||||| ||||| | |||| ||| |||| | | Sbjct: 51096 cagagaagggcatggctacctactccagtattcttgcctggcgaatcccatggactgaga 51155 Query: 429 agcctggcgggctacagt 446 || ||| ||||||||||| Sbjct: 51156 aggctgacgggctacagt 51173 Score = 63.9 bits (32), Expect = 9e-08 Identities = 83/100 (83%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| ||| || |||||| |||||||||||||||| |||| Sbjct: 98878 cctgggtcaggaagatcccctggaagtggaaatggcaacccactccagtattcttgccag 98937 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 | ||| |||||||||| | ||||||| |||||||||||| Sbjct: 98938 gcaaatcccacggacagagaagcctggtgggctacagtcc 98977 Score = 63.9 bits (32), Expect = 9e-08 Identities = 50/56 (89%) Strand = Plus / Minus Query: 391 ctccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagt 446 ||||||||||| ||||| |||||| |||||||||| ||||||||| ||||| |||| Sbjct: 65740 ctccagtattcttgcctggagaatcccacggacagtggagcctggtgggctgcagt 65685 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 12938 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 12997 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 12998 gcctggtgggct 13009 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||| | Sbjct: 40801 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggaa 40860 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 40861 gcctggtgggct 40872 Score = 60.0 bits (30), Expect = 1e-06 Identities = 85/102 (83%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| || ||||||||| |||||||| |||||| | ||| |||||||||| || | Sbjct: 49317 tccctgggttggaaagatcccctggagaaggaaatggcaaaccattccagtattcttggc 49376 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | |||| ||| | |||| | ||||||| |||||||||||| Sbjct: 49377 tgg-gaatcccatgaacagagaagcctggtgggctacagtcc 49417 Score = 60.0 bits (30), Expect = 1e-06 Identities = 60/70 (85%) Strand = Plus / Plus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 |||||||| |||||| ||||| |||||| |||| |||| ||||||||| ||||||||| Sbjct: 37991 acccactctggtattcttgcctggagaatcccaccaacagaggagcctggtgggctacag 38050 Query: 446 tccctagggt 455 ||||| |||| Sbjct: 38051 tccctggggt 38060 Score = 58.0 bits (29), Expect = 5e-06 Identities = 119/145 (82%), Gaps = 3/145 (2%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaa-tgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| ||||||||| | ||| ||| || | |||||| | || |||| |||||||| Sbjct: 16797 tggtaaagattctgcctgccagtgcaggagacacaggttcaatacccgggttgggaagat 16856 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcct-agagaataccacggac 423 |||| |||| ||| ||||| |||||||| |||||| ||||| ||| ||| ||| |||| Sbjct: 16857 cccctggaggaggacatggcaacccactctagtatttttgcctgaga-aatcccatggac 16915 Query: 424 aggggagcctggcgggctacagtcc 448 || ||||| ||| |||||||||||| Sbjct: 16916 agaggagcttggtgggctacagtcc 16940 Score = 58.0 bits (29), Expect = 5e-06 Identities = 47/53 (88%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 ||||||||| |||| ||||| | |||||||| |||||| |||||||||||||| Sbjct: 64126 tccctgggtcgggacgatcctctggagaaggaaatggcaacccactccagtat 64178 Score = 58.0 bits (29), Expect = 5e-06 Identities = 89/109 (81%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||||| |||| ||||||| ||| |||| |||||| ||| |||||||||| Sbjct: 19465 ggagaaggacatggcaaccccctccagtgttcttgccaggagaatcccagggacagggga 19406 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||| ||||| | ||| | |||||| | ||||||||| || ||||| Sbjct: 19405 gcctggtgggctgccgtctgtggggttgcacagagttggacacgactga 19357 >gb|CM000190| Bos taurus chromosome 14-FRAG[60030000,60129999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 151/171 (88%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||||||||| ||| ||| ||||||||||||||||| |||||||||| Sbjct: 15981 gtaaagaatctgcctgcaatgagggagacctgggttcagtccctgggtcaggaagatccc 16040 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||||||||||||||||||||||| |||| ||||| || ||| ||| |||||| | Sbjct: 16041 ctggagaagggaatggctacccactccagcattcctgcctggataattccaaggacagag 16100 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||||| |||||||||||| | |||| | ||||||||||| |||||||| Sbjct: 16101 gagcctggtgggctacagtccatggggtcgcaaagagttggacacaactga 16151 Score = 131 bits (66), Expect = 4e-28 Identities = 138/162 (85%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||| || ||| ||| || ||| ||| ||||||||| ||||||||||| Sbjct: 62935 gtaaagaatctgcccacagtgccggagcccagggctcaatccctgggttgggaagatccc 62876 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||||| ||||| |||||||| ||||||| ||||| |||||| ||| |||||| | Sbjct: 62875 ctggagaagggcatggcaacccactctagtattcttgcctggagaatcccatggacagag 62816 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||||||||||||||||| | |||| ||||||||||| Sbjct: 62815 gagcctggcgggctacagtccatggggtctcaaagagttgga 62774 Score = 129 bits (65), Expect = 2e-27 Identities = 95/105 (90%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||||||||||||| |||||||||||| |||||| |||||||||||||| |||||||| Sbjct: 31856 ggttcagtccctgggtcgggaagatcccctggagaaaggaatggctacccattccagtat 31797 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctaca 444 || ||||| |||||| ||| |||||| |||||||||| ||||||| Sbjct: 31796 tcttgcctggagaattccatggacagaggagcctggcaggctaca 31752 Score = 115 bits (58), Expect = 3e-23 Identities = 149/178 (83%), Gaps = 1/178 (0%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||||||||| ||| || |||||| ||||||||| || |||||||| Sbjct: 66856 gtaaagaatctgcctgcaatggaggaggcctgggttcgatccctgggttggaaagatccc 66797 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| | |||| ||||||| |||||||| ||||| |||||| | | |||||| | Sbjct: 66796 ctggagaaggaactggcaacccacttcagtattcctgcctggagaatcctatggacagag 66737 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 | |||||| |||||||||||| ||||| | ||||||| ||| || |||||||||||| Sbjct: 66736 gggcctggtgggctacagtccacagggtcgcaaagagtcggacac-actgaagcgact 66680 Score = 115 bits (58), Expect = 3e-23 Identities = 128/150 (85%), Gaps = 1/150 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||| | | ||| || | |||||||||||||||| || |||||| Sbjct: 80311 tggtaaagaatctgcctgcagttcaggagacacaggttcagtccctgggtcgg-aagatc 80253 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| |||| ||| |||||| | |||||||||||||| ||||| |||||| ||| |||||| Sbjct: 80252 ccctggaggaggaaatggcaaaccactccagtattcttgcctggagaatcccatggacag 80193 Query: 426 gggagcctggcgggctacagtccctagggt 455 || ||||||| ||| ||||||| |||||| Sbjct: 80192 aggcgcctggcaggccacagtccatagggt 80163 Score = 109 bits (55), Expect = 2e-21 Identities = 94/107 (87%) Strand = Plus / Minus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||||||||||| ||||||||| ||||||||||||||| |||||| |||| |||| Sbjct: 33574 ttcagtccctgggtgggaaagatcccctggagaagggaatggcaacccacaccagcattc 33515 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||| |||||| ||| |||||| || ||||| |||||||||||| Sbjct: 33514 ttgcctggagaatcccatggacagaagaacctggtgggctacagtcc 33468 Score = 99.6 bits (50), Expect = 2e-18 Identities = 101/118 (85%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||||| ||| ||| | |||| ||||||||| | ||| ||| Sbjct: 62962 tggtaaagaatccgcctgcaatgcaggagacctgcgttcgatccctgggttgagaaaatc 63021 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 63022 ccctggagaagggaaaggctacccactccagtattctggcctggagaattccatggac 63079 Score = 97.6 bits (49), Expect = 6e-18 Identities = 113/133 (84%), Gaps = 1/133 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| || |||||||| ||| ||| ||||| ||||||||| |||||||| Sbjct: 46092 atggtaaagaatttgattgcaatgcgggagacctgggtttgatccctgggttgggaagat 46151 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggac 423 |||| |||| |||| ||||| |||||||||||||||| ||||| |||||| ||| |||| Sbjct: 46152 cccctggaggagggcatggcaacccactccagtattcttgcctggagaatccccatggac 46211 Query: 424 aggggagcctggc 436 || |||||||||| Sbjct: 46212 agaggagcctggc 46224 Score = 95.6 bits (48), Expect = 2e-17 Identities = 84/96 (87%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||| ||| ||| ||| || ||| ||||||||| ||||||||| Sbjct: 52109 tggtaaagaatccgcctgcactgcaggagacctggattcgatccctgggttgggaagatc 52050 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||| |||| |||||||||||||||||||| Sbjct: 52049 ccctggagaaaggaaaggctacccactccagtattc 52014 Score = 93.7 bits (47), Expect = 1e-16 Identities = 101/119 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 85274 tggtaaagaatccacctgcaatgcgggagacctgggttcgatccctgggttgggaagatc 85215 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| ||||||||||| |||| ||||||| ||| ||| |||| |||||| ||| ||||| Sbjct: 85214 ccctggagaagggaacggctgcccactctagtgttctggcctggagaatcccatggaca 85156 Score = 91.7 bits (46), Expect = 4e-16 Identities = 88/102 (86%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||| | ||||||||||| |||||||||||||||| || |||| Sbjct: 96222 tccctgggttaggaagatccactggagaagggaacggctacccactccagtgttattgcc 96163 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||||| |||||| ||| ||||||||||| Sbjct: 96162 tggagaatgccatggacagaggagccaggccggctacagtcc 96121 Score = 89.7 bits (45), Expect = 2e-15 Identities = 102/121 (84%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| ||| |||||||| || |||||||||||||||| ||||| Sbjct: 30377 cctgggtcgggaagatcccctggaaaagggaatagcaacccactccagtattcttgcctg 30436 Query: 409 gagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttgg 468 || ||| || |||||| ||| ||||| ||||||||||| | |||||| ||||| |||| Sbjct: 30437 gaaaatctcatggacagaggatcctggtgggctacagtcgatggggttgcaaagaattgg 30496 Query: 469 a 469 | Sbjct: 30497 a 30497 Score = 83.8 bits (42), Expect = 9e-14 Identities = 109/130 (83%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 315 atctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggaga 374 ||||||| ||||||| ||| | | ||||||| | ||| ||| ||||| ||||| ||||| Sbjct: 64325 atctgcccgcaatgcgggagatctgggttcaattcctaggtcaggaagttcccctggaga 64266 Query: 375 agggaatggctacccactcc-agtattcatgcctagagaataccacggacaggggagcct 433 ||| |||||||||||||||| |||||| ||||| |||||| ||| |||||| ||||||| Sbjct: 64265 aggaaatggctacccactccgggtattcttgcctggagaatcccatggacagaggagcct 64206 Query: 434 ggcgggctac 443 ||| |||||| Sbjct: 64205 ggcaggctac 64196 Score = 83.8 bits (42), Expect = 9e-14 Identities = 118/142 (83%), Gaps = 1/142 (0%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||| ||||||||||||||| ||| ||| |||||| |||||||| ||||||||| Sbjct: 35019 ggtaaggaatctgcctgcaatataggagacctgggttcgatccctgggccaggaagatcc 34960 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 | ||||||| | |||| || ||||||||||||| ||||| |||||| ||| |||||| Sbjct: 34959 ct-ggagaagatactggcaactcactccagtattcttgcctggagaatcccatggacaga 34901 Query: 427 ggagcctggcgggctacagtcc 448 ||||||||| |||||||||||| Sbjct: 34900 ggagcctggtgggctacagtcc 34879 Score = 77.8 bits (39), Expect = 6e-12 Identities = 82/95 (86%), Gaps = 1/95 (1%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||| ||||||||||||| ||| |||| |||||| | ||||||| ||||||||| Sbjct: 45976 ggtaaagaa-ctgcctgcaatgcaggagaccctggttcaattcctgggtcaggaagatcc 46034 Query: 367 cccggagaagggaatggctacccactccagtattc 401 || ||| |||||| ||| |||||||||||||||| Sbjct: 46035 cctggaaaagggataggccacccactccagtattc 46069 Score = 77.8 bits (39), Expect = 6e-12 Identities = 103/123 (83%), Gaps = 1/123 (0%) Strand = Plus / Minus Query: 343 tcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattca 402 ||||||||||| | |||| ||||||| |||| |||| | ||| |||||||||||||||| Sbjct: 41837 tcagtccctggtttgggatgatcccctggaggagggcacggcaacccactccagtattct 41778 Query: 403 tgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaag 462 || || |||||| ||| ||||| |||||||||| ||||||||||| | |||| | |||| Sbjct: 41777 tg-ctggagaatcccatggacaaaggagcctggcaggctacagtccatggggtcgcaaag 41719 Query: 463 agt 465 ||| Sbjct: 41718 agt 41716 Score = 75.8 bits (38), Expect = 2e-11 Identities = 87/102 (85%), Gaps = 1/102 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctg-caatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||| |||||||| ||||| ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 37327 ggtaaagcatctgccttacaatgtgggagacctgggttcaatccctgggtcgggaagatc 37386 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcct 407 || |||||||| |||||| |||| ||||||||||| ||||| Sbjct: 37387 tcctggagaaggaaatggcaaccccctccagtattcttgcct 37428 Score = 75.8 bits (38), Expect = 2e-11 Identities = 84/98 (85%), Gaps = 1/98 (1%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| | || |||| ||||| ||||||||||||| || |||| Sbjct: 26842 tccctgggttgggaagatcccctgcaggagggcatggcaacccactccagtactcttgcc 26783 Query: 407 tagagaat-accacggacaggggagcctggcgggctac 443 | |||||| ||| |||||| |||||||||| |||||| Sbjct: 26782 tggagaatccccatggacagaggagcctggcaggctac 26745 Score = 75.8 bits (38), Expect = 2e-11 Identities = 118/142 (83%), Gaps = 2/142 (1%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||| | | ||| || ||||||| | ||||||| || |||||| Sbjct: 75960 tggtaaagaatctgcctgccaaacaggagactcgggttccattcctgggttggaaagatc 76019 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcct-agagaataccacggaca 424 ||| |||| ||| |||||| ||||||||||| | || ||||| ||| ||| ||| ||||| Sbjct: 76020 ccctggaggaggaaatggcaacccactccaggactcttgcctgaga-aatcccatggaca 76078 Query: 425 ggggagcctggcgggctacagt 446 | ||||||||| |||||||||| Sbjct: 76079 gaggagcctggtgggctacagt 76100 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||| |||||||||||||||| ||| |||| | ||| | ||||||| ||||||||| Sbjct: 52228 tggtaaacaatctgcctgcaatgcaggagaccccgattcgattcctgggttgggaagatc 52169 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | ||||||| | |||||||||||||||||||| Sbjct: 52168 cgctggagaagaaataggctacccactccagtattc 52133 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 79942 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 80001 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 80002 gcctggtgggct 80013 Score = 71.9 bits (36), Expect = 4e-10 Identities = 119/144 (82%), Gaps = 2/144 (1%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||| | ||| |||||| || ||| ||||||| |||||||| |||||||||| Sbjct: 48871 ggtaaagaatttaccttcaatgcaggggacctgggttcaacccctgggttgggaagatcc 48930 Query: 367 ccc-ggagaagggaatggctacccactccagtattcatgcctagagaat-accacggaca 424 ||| |||| |||| ||||| | || |||||||||| |||| |||||| ||| ||||| Sbjct: 48931 ccctggaggagggcatggcaatcccctccagtattttcgcctggagaatccccatggaca 48990 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||||| |||||||||||| Sbjct: 48991 gaggagcctggtgggctacagtcc 49014 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 45821 ggagaagaaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 45880 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 45881 gcctggtgggct 45892 Score = 63.9 bits (32), Expect = 9e-08 Identities = 63/72 (87%), Gaps = 1/72 (1%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 64807 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggac-gggga 64865 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 64866 gcctggtgggct 64877 Score = 61.9 bits (31), Expect = 3e-07 Identities = 94/115 (81%) Strand = Plus / Minus Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| |||||| |||||||| ||| ||| ||||| |||||| ||| || | |||||| Sbjct: 90257 gagaaggaaatggcaacccactctagtgttcttgcctggagaatcccaggggcgggggag 90198 Query: 431 cctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 ||||| ||||| | ||| | |||||| | ||||||||| || ||||| |||||| Sbjct: 90197 cctggtgggctgccgtctatggggttgcacagagttggacacgactgaggcgact 90143 Score = 61.9 bits (31), Expect = 3e-07 Identities = 52/59 (88%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctaca 444 |||||||||||||| | ||||| |||||| ||| |||||| ||||||||| |||||||| Sbjct: 29660 acccactccagtatccttgcctggagaatgccatggacagaggagcctggtgggctaca 29602 Score = 60.0 bits (30), Expect = 1e-06 Identities = 60/70 (85%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 ||||||||||||| || ||||| || ||| ||| |||||| |||||||||| |||||||| Sbjct: 67774 acccactccagtactcttgcctggaaaatcccaaggacagaggagcctggcaggctacag 67715 Query: 446 tccctagggt 455 || |||||| Sbjct: 67714 cccatagggt 67705 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||| || ||| ||||| |||||| ||| |||| ||||| Sbjct: 78879 ggagaaggaaatggcaacccactcctgtgttcttgcctggagaatcccagggacggggga 78820 Query: 430 gcctgg 435 |||||| Sbjct: 78819 gcctgg 78814 Score = 60.0 bits (30), Expect = 1e-06 Identities = 93/114 (81%) Strand = Plus / Minus Query: 352 gggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctagag 411 |||| |||| ||||||| |||| ||| || ||| |||||| |||||||||||||||| Sbjct: 75094 gggttgggaggatcccctggagtaggaaacggcaacccacatcagtattcatgcctagga 75035 Query: 412 aataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 ||| ||| |||||| |||||||| |||||| ||||| | |||| | ||||||| Sbjct: 75034 aatcccatggacagaggagcctgatgggctatagtccatggggtcgcaaagagt 74981 Score = 60.0 bits (30), Expect = 1e-06 Identities = 54/62 (87%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||| |||||||||||||| ||| ||| |||||| ||||||||| ||||||||| Sbjct: 33286 ggtaaagagtctgcctgcaatgcaggagacctgggttcgatccctgggtcaggaagatcc 33345 Query: 367 cc 368 || Sbjct: 33346 cc 33347 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||| | |||||| ||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 35347 ggagaaagaaatggcaccccactccagtgttcttgcctggagaatcccagggacagggga 35288 Query: 430 gcctgg 435 |||||| Sbjct: 35287 gcctgg 35282 Score = 58.0 bits (29), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Plus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| ||||||||||| |||| ||| ||||| ||||| | || ||||||||||| | Sbjct: 13373 ctgggtcgggaagatcccttggagcggggcatggcaacccatttcaatattcatgcctgg 13432 Query: 410 agaataccacggacaggggagcctggcgggcta 442 ||||| ||| |||||| ||||||| | |||||| Sbjct: 13433 agaatcccatggacagaggagcctagtgggcta 13465 Score = 58.0 bits (29), Expect = 5e-06 Identities = 62/73 (84%) Strand = Plus / Plus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| ||||||||||| |||| ||| ||||| |||||||||| ||||| Sbjct: 71394 ttcaatccctgggtcgggaagatcccttggaggcgggcatggcaacccactccaatattc 71453 Query: 402 atgcctagagaat 414 ||||| |||||| Sbjct: 71454 ttgcctggagaat 71466 >gb|CM000189| Bos taurus chromosome 13-FRAG[56250000,56349999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 164/187 (87%), Gaps = 1/187 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| | ||||| ||||||| | |||||| Sbjct: 25524 atggtaaagaatctgcctgcaatgcaggagacctgagttcaatccctggctccagaagat 25465 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| | |||||||||||||||||||||||||||||| ||||| |||||||||| ||||| Sbjct: 25464 cccctgaagaagggaatggctacccactccagtattcttgcctggagaataccatggaca 25405 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | | |||||||| ||||||||||| ||| |||| ||||||||||| |||||| ||||||| Sbjct: 25404 gagaagcctggcaggctacagtccatagtgttgcaaagagttggacacaact-aagcgac 25346 Query: 485 tcacact 491 | ||||| Sbjct: 25345 taacact 25339 Score = 145 bits (73), Expect = 3e-32 Identities = 124/141 (87%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| |||||||||| ||| || | |||||| |||||||||||||||||||| Sbjct: 56576 ggtaaagaatccacctgcaatgcaggagacacaggttcaatccctgggtggggaagatcc 56517 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 56516 cctggagaaggaaatggcaacccactccagtattcttgcctggagaattccatggacaga 56457 Query: 427 ggagcctggcgggctacagtc 447 | ||||||| ||||||||||| Sbjct: 56456 gaagcctggtgggctacagtc 56436 Score = 101 bits (51), Expect = 4e-19 Identities = 99/115 (86%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||||| | ||| ||| |||||| ||||||||| ||||||||||| Sbjct: 10330 taaagaatctgcctgcaattcaggagacctgggttctatccctgggtcaggaagatcccc 10271 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||||||||| ||||||||||||||||| | |||| |||||| |||||||| Sbjct: 10270 tggagaagggaaaggctacccactccagtagtttggcctggagaattccacggac 10216 Score = 91.7 bits (46), Expect = 4e-16 Identities = 82/94 (87%) Strand = Plus / Minus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| ||||||||| |||||||||||| ||||||||||||||| |||||||||| |||| Sbjct: 36699 gttcaatccctgggttgggaagatcccctggagaagggaatggcaacccactccattatt 36640 Query: 401 catgcctagagaataccacggacaggggagcctg 434 ||||| || ||| ||| |||||| |||||||| Sbjct: 36639 attgcctggaaaattccatggacagaggagcctg 36606 Score = 87.7 bits (44), Expect = 6e-15 Identities = 107/128 (83%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 |||||||| ||||||||| ||||||||||| ||| ||| |||||| |||||||||||| Sbjct: 8118 cgggttcaatccctgggtcaggaagatcccctagaggaggaaatggcaacccactccagt 8059 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttg 457 |||| ||||| |||||| ||| |||||| |||||| || | ||||||||| | ||||| Sbjct: 8058 attcttgcctggagaatcccatggacagaggagcccggtagactacagtccatggggttt 7999 Query: 458 aaaagagt 465 ||||||| Sbjct: 7998 caaagagt 7991 Score = 79.8 bits (40), Expect = 1e-12 Identities = 74/84 (88%), Gaps = 1/84 (1%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||| ||||||||||||||||||||| ||||| |||||||| || | Sbjct: 60234 tccctgggtcgggaagattccccggagaagggaatggcta-ccacttcagtattcgtgtc 60292 Query: 407 tagagaataccacggacaggggag 430 | |||||| ||| |||||| |||| Sbjct: 60293 tggagaatcccatggacagaggag 60316 Score = 77.8 bits (39), Expect = 6e-12 Identities = 78/91 (85%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| ||||||||||||| | |||| ||||| ||||| ||||| |||||| || Sbjct: 17075 ggaagatcccctggagaagggaatgacaacccgctccaatattcttgcctggagaatccc 17016 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| ||||||| | |||||| ||||| Sbjct: 17015 atggacagaggagcctagtgggctaaagtcc 16985 Score = 75.8 bits (38), Expect = 2e-11 Identities = 95/114 (83%) Strand = Plus / Minus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| | ||||||| || |||| |||| ||||| ||||||||||| ||| Sbjct: 21765 ttcaatccctgggtcgagaagatctcctggaggagggcatggcaacccactccagcgttc 21706 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 ||||| |||||| ||| |||| | ||||||||| ||||||||| || |||||| Sbjct: 21705 ttgcctggagaatcccatggactgaggagcctggtgggctacaggccttagggt 21652 Score = 73.8 bits (37), Expect = 9e-11 Identities = 55/61 (90%) Strand = Plus / Plus Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcggg 439 ||||| ||||||||||||||| ||||| |||||| |||||||||| ||||||||||||| Sbjct: 1283 atggcaacccactccagtatttttgcctggagaattccacggacagaggagcctggcggg 1342 Query: 440 c 440 | Sbjct: 1343 c 1343 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||| |||||||||| ||| ||| ||||||| |||| | || || |||||| Sbjct: 78383 tggtaaagaattcgcctgcaatgagggagacctgggttcaatcccggtgttggaaagatc 78324 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||||| || ||||||||||||||||||| Sbjct: 78323 ccctggagaaggaaacagctacccactccagtattc 78288 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||||| |||| Sbjct: 8428 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacaaggga 8369 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 8368 gcctggtgggct 8357 Score = 71.9 bits (36), Expect = 4e-10 Identities = 84/100 (84%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| || ||||| |||| | |||||||||||||||| ||||| Sbjct: 4462 cctgggtcaggaagatcccctggggaaggaaatgacaacccactccagtattcttgcctg 4403 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 |||||| | |||||| |||||||||| ||||| ||||| Sbjct: 4402 gagaatttcgtggacagaggagcctggcaggctatagtcc 4363 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||| ||| |||| |||| ||||| ||||||||||| |||| ||||| |||||| || Sbjct: 16324 ggaagattccctggaggagggcatggcaacccactccaggattcttgcctggagaatccc 16265 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| ||||| |||| |||| |||||| Sbjct: 16264 atggacagcggagcgtggcaggctgcagtcc 16234 Score = 69.9 bits (35), Expect = 1e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 380 atggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcggg 439 ||||| |||||||||||||||| ||||| |||||| ||| |||||| | ||||||| ||| Sbjct: 62112 atggcaacccactccagtattcttgcctggagaatcccatggacagagaagcctggaggg 62053 Query: 440 ctacagtccctagggttgaaaagagttggatacaactga 478 |||||||| | || | ||||||||||| |||||||| Sbjct: 62052 atacagtccttgggctcacaaagagttggacacaactga 62014 Score = 67.9 bits (34), Expect = 6e-09 Identities = 94/114 (82%) Strand = Plus / Minus Query: 335 acccgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactcc 394 |||| |||||| ||||||||| ||||||||||| |||| || ||||| ||| ||||| Sbjct: 42589 acccaggttcaatccctgggtcaggaagatcccctggaggagaacatggcaacctactcc 42530 Query: 395 agtattcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||||| ||||| |||||| ||| |||||| ||| |||| |||| ||||||| Sbjct: 42529 agtattcttgcctggagaatcccatggacagaggaacctgatgggcaacagtcc 42476 Score = 67.9 bits (34), Expect = 6e-09 Identities = 85/102 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| | ||||||||| |||||||| |||||| | ||||||||||||| |||| Sbjct: 41310 tccctgggttgagaagatcccttggagaaggaaatggcaatgcactccagtattcttgcc 41251 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | ||| ||| |||||| ||||||||| |||||||||||| Sbjct: 41250 agggaaatgccatggacagaggagcctggtgggctacagtcc 41209 Score = 65.9 bits (33), Expect = 2e-08 Identities = 57/65 (87%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 |||||||| || |||||||| |||| |||| ||||| ||||||||||||||| |||||| Sbjct: 55963 cctgggtgaggcagatcccctggaggagggcatggcaacccactccagtatttttgccta 56022 Query: 409 gagaa 413 ||||| Sbjct: 56023 gagaa 56027 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 26323 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 26382 Query: 430 gcctggcgggct 441 ||||| ||||| Sbjct: 26383 tcctggtgggct 26394 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| ||||| Sbjct: 96819 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggatggggga 96760 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 96759 gcctggtgggct 96748 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 68921 ggagaaggaaatggcatcccactccagtgttcttgcctggagaatcccagggacggggga 68980 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 68981 gcctggtgggct 68992 Score = 61.9 bits (31), Expect = 3e-07 Identities = 46/51 (90%) Strand = Plus / Minus Query: 375 agggaatggctacccactccagtattcatgcctagagaataccacggacag 425 |||||||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 96933 agggaatggcaacccactccagtattcttgcctggagaatcccatggacag 96883 Score = 58.0 bits (29), Expect = 5e-06 Identities = 56/64 (87%), Gaps = 2/64 (3%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatccc--ccggagaagggaatggctacccactccagt 397 |||||||| ||||||| ||||||||| |||||||||| |||||| |||||||||||| Sbjct: 58605 ggttcagttcctgggtcaggaagatcctgaccggagaaggaaatggcaacccactccagt 58664 Query: 398 attc 401 |||| Sbjct: 58665 attc 58668 >gb|CM000187| Bos taurus chromosome 11-FRAG[15120000,15219999] Length = 100000 Score = 180 bits (91), Expect = 5e-43 Identities = 170/195 (87%), Gaps = 1/195 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||||||||||||| ||| ||| ||||| ||||||||| |||||||| Sbjct: 29534 atggtaaagaatctgcctgcaatgtgggagacctgggtttgatccctgggttgggaagat 29593 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||||| |||||||||||||| ||||| |||||| ||| ||||| Sbjct: 29594 ccccaggagaagggaatggctaaccactccagtattcttgcctggagaattccaaggaca 29653 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | |||||||||||||||||||||| | |||| ||||||||||| ||||||| || ||| Sbjct: 29654 gaggagcctggcgggctacagtccgtggggtcacaaagagttggacacaactg-agtgac 29712 Query: 485 tcacactttcacttt 499 | |||||||||||| Sbjct: 29713 tttcactttcacttt 29727 Score = 139 bits (70), Expect = 2e-30 Identities = 145/170 (85%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 |||||||||||||||||||| |||||| ||||| ||||| ||| ||||||||||| Sbjct: 29329 taaagaatctgcctgcaatgaaagaaacctgggtttgatccctcggttaggaagatcccc 29270 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||| |||||||||||||||||||||||||||| ||||| |||||| ||| |||||| || Sbjct: 29269 tggaaaagggaatggctacccactccagtattcttgcctggagaattccatggacagagg 29210 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||||| || |||||||| | || ||| ||||||||||| || ||||| Sbjct: 29209 agcctggcaggttacagtccatgggtttgcaaagagttggacacgactga 29160 Score = 137 bits (69), Expect = 7e-30 Identities = 144/169 (85%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||| ||||||||| | | |||| || | ||||||||| |||||||| Sbjct: 29085 atggtaaagaatctgtctgcaatgcagaagacccaggcttgatccctgggtcgggaagat 29026 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||| ||||||||||||||||||||||| ||||| ||||| ||| ||||| Sbjct: 29025 cccctggagaaggaaatggctacccactccagtattcttgccttgagaagtccatggaca 28966 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggataca 473 | |||||||||| || || ||||| | |||||| ||||||| ||||||| Sbjct: 28965 gaggagcctggcaggttatagtccgtggggttgcaaagagtcggataca 28917 Score = 115 bits (58), Expect = 3e-23 Identities = 121/142 (85%) Strand = Plus / Minus Query: 324 caatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaagggaatgg 383 |||||| ||| ||||||||| ||||||||| |||||||||||| |||||||| ||||| Sbjct: 78158 caatgcgggagacccgggtttgatccctgggttgggaagatcccctggagaaggaaatgg 78099 Query: 384 ctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctac 443 | |||||||||||||||| |||||||| ||| ||| ||| | ||||||||| |||||| Sbjct: 78098 caacccactccagtattcttgcctagaaaattccatggatggaggagcctggtgggctat 78039 Query: 444 agtccctagggttgaaaagagt 465 ||||| | |||||| ||||||| Sbjct: 78038 agtccatggggttgcaaagagt 78017 Score = 97.6 bits (49), Expect = 6e-18 Identities = 88/101 (87%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| ||||||||| ||| |||||| | |||| |||||||||| ||||||||||||||| Sbjct: 37917 gttcaatccctgggtagggtagatcctctggaggagggaatggcaacccactccagtatt 37976 Query: 401 catgcctagagaataccacggacaggggagcctggcgggct 441 | ||||||||| || ||| |||||| ||||||||| ||||| Sbjct: 37977 cttgcctagaggatcccatggacagaggagcctggtgggct 38017 Score = 77.8 bits (39), Expect = 6e-12 Identities = 66/75 (88%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| |||||||||||| |||| | ||||||| |||||||||||||| Sbjct: 74137 ggttcaatccctgggttgggaagatcccctggaggacagaatggcaacccactccagtat 74196 Query: 400 tcatgcctagagaat 414 || ||||| |||||| Sbjct: 74197 tcttgcctggagaat 74211 Score = 77.8 bits (39), Expect = 6e-12 Identities = 90/107 (84%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| |||||| | |||| |||||||||||||||| ||||| Sbjct: 31482 cctgggttaggaagatcccctggagaaaagcatggtaacccactccagtattcttgcctg 31541 Query: 409 gagaataccacggacaggggagcctggcgggctacagtccctagggt 455 |||| | ||| || ||| ||||||||| |||||| |||||||||||| Sbjct: 31542 gagagtcccatggccagaggagcctggtgggctatagtccctagggt 31588 Score = 77.8 bits (39), Expect = 6e-12 Identities = 111/135 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| |||||||| ||||| || | ||| ||||||| |||| Sbjct: 14918 tccctgggttgggaagatcccctggagaaggaaatggtaacaccctctagtattcttgcc 14859 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| | | |||||| |||||||| |||||| ||||| || ||| | ||||||| Sbjct: 14858 tggagaatcctatggacagatgagcctggtgggctatagtccataaggtagcaaagagtc 14799 Query: 467 ggatacaactgaagc 481 || ||||||||||| Sbjct: 14798 agacacaactgaagc 14784 Score = 75.8 bits (38), Expect = 2e-11 Identities = 59/66 (89%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 53750 ggagaaggaaatggcaacccactccagtgttcttgcctggagaattccagggacagggga 53691 Query: 430 gcctgg 435 |||||| Sbjct: 53690 gcctgg 53685 Score = 73.8 bits (37), Expect = 9e-11 Identities = 97/117 (82%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 |||||||||||||||||||| |||||||| |||||| |||||||||| | ||| ||||| Sbjct: 22475 cctgggtggggaagatcccctggagaaggaaatggcaacccactccatttttcttgcctg 22416 Query: 409 gagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||| | ||| || ||||||||| ||||||||||| | |||||| ||||||| Sbjct: 22415 ggaaatcctgtggagagaggagcctggtgggctacagtctgtggggttgcaaagagt 22359 Score = 73.8 bits (37), Expect = 9e-11 Identities = 64/73 (87%) Strand = Plus / Plus Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| |||| Sbjct: 84222 cggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggg 84281 Query: 429 agcctggcgggct 441 ||||||| ||||| Sbjct: 84282 agcctggtgggct 84294 Score = 71.9 bits (36), Expect = 4e-10 Identities = 84/100 (84%) Strand = Plus / Plus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 |||||||||||||||| ||||| || || |||||||||| |||||||||| |||| | Sbjct: 98363 acccactccagtattcttgcctggaaaaccccacggacagaggagcctggccagctatgg 98422 Query: 446 tccctagggttgaaaagagttggatacaactgaagcgact 485 ||| ||||||| | ||||||||| |||||||||| |||| Sbjct: 98423 tccacagggttgcacagagttggacacaactgaagtgact 98462 Score = 71.9 bits (36), Expect = 4e-10 Identities = 75/88 (85%) Strand = Plus / Plus Query: 390 actccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtccc 449 |||||||||||| ||||| |||||| ||| ||||| | |||||||| |||| |||||| Sbjct: 36844 actccagtattcttgcctggagaattccatggacaaagaagcctggcaggctgcagtcca 36903 Query: 450 tagggttgaaaagagttggatacaactg 477 | |||||| ||||||||||| ||||||| Sbjct: 36904 tggggttgcaaagagttggacacaactg 36931 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 10488 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 10547 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 10548 gcctggtgggct 10559 Score = 71.9 bits (36), Expect = 4e-10 Identities = 106/128 (82%), Gaps = 1/128 (0%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||| ||||| ||||| ||| |||| ||||| ||||||| | |||||||| Sbjct: 86943 tggtaaagaatccacctgccaatgcaggagacccaggttcgatccctggatcgggaagat 87002 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||||||| |||||| ||||||||||| |||| || | |||||| |||| |||| Sbjct: 87003 tccctggagaaggaaatggcaacccactccagcattcttgtcaggagaattccacagaca 87062 Query: 425 ggggagcc 432 | |||||| Sbjct: 87063 gaggagcc 87070 Score = 67.9 bits (34), Expect = 6e-09 Identities = 61/70 (87%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 |||||||||||||||| ||||| | ||| ||| |||||| |||||||||| |||||||| Sbjct: 50316 acccactccagtattcttgcctgggaaatcccatggacagaggagcctggcaggctacag 50257 Query: 446 tccctagggt 455 ||| |||||| Sbjct: 50256 tccatagggt 50247 Score = 63.9 bits (32), Expect = 9e-08 Identities = 60/68 (88%), Gaps = 1/68 (1%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||||||||||||| ||| |||||||| |||||| |||||||||||| ||| || | Sbjct: 1095 tccctgggtggggaagat-ccctggagaaggaaatggcaacccactccagtgttcttgtc 1037 Query: 407 tagagaat 414 | |||||| Sbjct: 1036 tggagaat 1029 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| ||| |||||| |||||||||||| ||| ||||| |||||| ||| ||||||| || Sbjct: 77125 ggaggaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacaggaga 77184 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 77185 gcctggtgggct 77196 Score = 58.0 bits (29), Expect = 5e-06 Identities = 75/89 (84%), Gaps = 1/89 (1%) Strand = Plus / Plus Query: 390 actccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtccc 449 |||||||||||| ||||| |||||| ||| |||||| | || ||||| |||||||||||| Sbjct: 41196 actccagtattcttgcctggagaatcccatggacagagaag-ctggcaggctacagtccc 41254 Query: 450 tagggttgaaaagagttggatacaactga 478 | |||| |||||||||| |||||||| Sbjct: 41255 tggggtcacaaagagttgggcacaactga 41283 >gb|CM000185| Bos taurus chromosome 9-FRAG[18360000,18459999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 153/174 (87%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| ||||||| ||||||||| ||||||| Sbjct: 12251 atggtaaagaatctgcctgcaatgcaggagacctgggttcaatccctgggtcaggaagat 12192 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| ||||| |||||| ||| ||||| Sbjct: 12191 cccctggagaagggaatggctacccactccagtattcttgcctggagaatcccatggaca 12132 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | | |||||||| ||||||||||| | |||| ||||||| ||| |||||||| Sbjct: 12131 gagtagcctggcaggctacagtccatggggtcacaaagagtcggacacaactga 12078 Score = 125 bits (63), Expect = 3e-26 Identities = 120/139 (86%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||| |||||||||| ||| ||| ||| |||||| ||||||||| |||||||||| Sbjct: 16639 gtaaagagtctgcctgcagtgcaggagacctgggttcgatccctgggtcgggaagatccg 16698 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||| |||||||| |||||||||||||||| ||||| |||||| ||| |||||| | Sbjct: 16699 ctggagaaaggaatggcaacccactccagtattcttgcctggagaattccatggacagag 16758 Query: 428 gagcctggcgggctacagt 446 |||||| || ||||||||| Sbjct: 16759 gagcctcgcaggctacagt 16777 Score = 91.7 bits (46), Expect = 4e-16 Identities = 128/154 (83%), Gaps = 1/154 (0%) Strand = Plus / Minus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 ||||||| | |||| ||| |||| ||||| ||||||||| ||||| ||| | |||||| Sbjct: 8089 tctgcctactatgcgggagacccaggttccatccctgggtcaggaaggtcctctggagaa 8030 Query: 376 gggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctgg 435 |||||| || ||||||||||||| || ||||| |||||| ||| |||||| ||||||||| Sbjct: 8029 gggaatagcaacccactccagtactcttgcctggagaatcccatggacagaggagcctgg 7970 Query: 436 cgggctacagtccctagggttgaaaagagttgga 469 ||||||||| || |||| ||||||||||||| Sbjct: 7969 taggctacagt-ccaggggtcgaaaagagttgga 7937 Score = 91.7 bits (46), Expect = 4e-16 Identities = 88/102 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||| |||||||| |||||| | ||||| ||||||||| |||||||| Sbjct: 5797 tggtaaagaatctgcttgcaatgcaggaaactctggttccatccctgggtcaggaagatc 5856 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcct 407 | | ||| |||| |||||| |||||||||||||||| ||||| Sbjct: 5857 ctctggaaaaggaaatggcaacccactccagtattcctgcct 5898 Score = 83.8 bits (42), Expect = 9e-14 Identities = 84/98 (85%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||| | |||| | || ||||| |||||||||||||||| ||||| |||||| || Sbjct: 55181 ggaagatcctctggaggaaggcatggcaacccactccagtattcttgcctggagaatccc 55122 Query: 418 acggacaggggagcctggcgggctacagtccctagggt 455 | |||||| ||| |||||| ||||||||||| |||||| Sbjct: 55121 agggacagaggaacctggcaggctacagtccatagggt 55084 Score = 83.8 bits (42), Expect = 9e-14 Identities = 118/142 (83%), Gaps = 1/142 (0%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||| ||||||||||||||| ||| |||||||||| | ||||||| |||||||| | Sbjct: 36115 ggtaaagcatctgcctgcaatgcaggagacccgggttcgattcctgggtcgggaagat-c 36173 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||||||| |||||| | ||||||||| | || || || || ||| ||| |||| | Sbjct: 36174 cctggagaaggaaatggcaatccactccagcactcttgtctggaaaatcccatggacgga 36233 Query: 427 ggagcctggcgggctacagtcc 448 |||||||| | ||||||||||| Sbjct: 36234 ggagcctgacaggctacagtcc 36255 Score = 81.8 bits (41), Expect = 4e-13 Identities = 117/141 (82%), Gaps = 1/141 (0%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||| ||||| |||||||||| | |||| |||| ||||| ||||||||||||| Sbjct: 99982 gggttcaatccatgggttgggaagatcctctggaggagggcatggcaacccactccagta 99923 Query: 399 ttcatgcctagagaat-accacggacaggggagcctggcgggctacagtccctagggttg 457 ||| ||||| |||||| ||| ||||| |||||||| |||||||||||| |||| | Sbjct: 99922 ttcttgcctggagaatccccatggacaaaggagcctgatgggctacagtccacggggtcg 99863 Query: 458 aaaagagttggatacaactga 478 ||||||||||| || ||||| Sbjct: 99862 caaagagttggacacgactga 99842 Score = 81.8 bits (41), Expect = 4e-13 Identities = 107/129 (82%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||| |||||| |||||| | ||| ||| |||||| ||||||| | |||||||||| Sbjct: 36827 ggtaaagcatctgcttgcaatacaggagacctgggttcgatccctggatcgggaagatcc 36768 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || ||||||| |||||| ||||||||| |||||| ||||| || ||| ||| |||||| Sbjct: 36767 cctagagaaggaaatggcaacccactccggtattcttgcctggaaaatcccatggacaga 36708 Query: 427 ggagcctgg 435 | ||||||| Sbjct: 36707 gaagcctgg 36699 Score = 81.8 bits (41), Expect = 4e-13 Identities = 141/173 (81%), Gaps = 1/173 (0%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||||||||||| |||| | | | || |||| ||| ||| | |||||||||| Sbjct: 61263 ggtaaagaatctgcctgcgatgcagaagaaccaggtttgatccgtggattgggaagatcc 61204 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaatacc-acggacag 425 | |||| || | ||||| |||||||||||||||| ||||| |||||| || | |||||| Sbjct: 61203 tctggaggagagcatggcaacccactccagtattcttgcctggagaatccctaaggacag 61144 Query: 426 gggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 |||||||||| ||||||||||| |||||| ||||| ||||| || ||||| Sbjct: 61143 aggagcctggcaggctacagtccaaggggttgcaaagatttggacacgactga 61091 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| |||| |||||| ||| |||| ||||| Sbjct: 56896 ggagaaggaaatggcaacccactccagtgttcttgcccggagaatcccagggacggggga 56837 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| || |||||| | ||||| ||| || |||||||||||| Sbjct: 56836 gcctggtgggctgccgtctctggggttgcacagagtcggacacgactgaagcgact 56781 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||| ||||| Sbjct: 44646 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacggggga 44587 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 44586 gcctggtgggct 44575 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 56319 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 56378 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 56379 gcctggtgggct 56390 Score = 79.8 bits (40), Expect = 1e-12 Identities = 91/108 (84%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 |||||||||| |||| ||| |||||| ||||||||||||||| ||||| |||||| || Sbjct: 96462 ggaagatcccttggaggaggaaatggcagcccactccagtattcttgcctggagaatccc 96521 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| ||| | |||| ||||||||||| | |||| ||||||||| Sbjct: 96522 atggacagaggaacttggcaggctacagtccatggggtcgaaaagagt 96569 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||| | |||||| ||| |||| ||||| Sbjct: 65272 ggagaaggaaatggcaacccactccagtattcttgcttggagaatcccagggacggggga 65213 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| || |||||| | ||||| | | || |||||||||||| Sbjct: 65212 gcctggtgggctgccgtctctggggttgcacagagtcgaacacgactgaagcgact 65157 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||| |||| Sbjct: 51830 ggagaaggaaatggcagcccactccagtgttcttgcctggagaatcccagggacgcggga 51771 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| || |||||| | ||||||||| ||||||||| ||||| Sbjct: 51770 gcctggtgggctgccgtctctggggttgcacagagttggacacaactgaatcgact 51715 Score = 77.8 bits (39), Expect = 6e-12 Identities = 99/119 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| | |||||| |||||| |||||||||||||||| |||| Sbjct: 69353 tccctgggttgggaagatcccctgaagaaggaaatggcaacccactccagtattcttgcc 69412 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 |||||| ||| ||||| ||| ||| || ||||| ||||| | |||| | ||||||| Sbjct: 69413 cggagaatcccattgacagaggaacctagcaggctatagtccatggggtcgcaaagagt 69471 Score = 77.8 bits (39), Expect = 6e-12 Identities = 63/71 (88%) Strand = Plus / Minus Query: 371 gagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggag 430 ||||||| |||||| |||||||||||||||| |||||||||||| ||| |||| ||||| Sbjct: 33366 gagaaggaaatggcaacccactccagtattcttgcctagagaatcccagggacgggggaa 33307 Query: 431 cctggcgggct 441 ||||| ||||| Sbjct: 33306 cctggtgggct 33296 Score = 77.8 bits (39), Expect = 6e-12 Identities = 84/99 (84%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||| |||||| | ||||| ||| ||| |||||| ||||||||| |||||||||||| Sbjct: 25787 taaagcatctgcatccaatgtgggagacctgggttcgatccctgggttgggaagatcccc 25728 Query: 369 cggagaagggaatggctacccactccagtattcatgcct 407 |||||||| ||||| |||||||||||||||| ||||| Sbjct: 25727 tggagaaggaaatggtaacccactccagtattcttgcct 25689 Score = 77.8 bits (39), Expect = 6e-12 Identities = 158/195 (81%), Gaps = 2/195 (1%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||| |||| | ||| |||| |||| ||||||||| |||||| | Sbjct: 99033 atggtaaagaatctgccaacaattcaggagacccaggttagatccctgggttgggaag-t 99091 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||| ||| ||||| |||| |||| |||||| ||| |||||||| | | |||| Sbjct: 99092 cccctggaggcgggcatggcaaccccctcccgtattcttgcttagagaatcctatggact 99151 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgac 484 | ||||||||| ||||||||| || |||||| ||||||||||| |||| || ||| || Sbjct: 99152 gaggagcctggtgggctacagcccatagggtcacaaagagttggacacaagtg-agcaac 99210 Query: 485 tcacactttcacttt 499 | |||||||||||| Sbjct: 99211 tatcactttcacttt 99225 Score = 73.8 bits (37), Expect = 9e-11 Identities = 58/65 (89%) Strand = Plus / Plus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| ||||||||||| |||||||||||||||||||| |||| |||||| ||| Sbjct: 48013 gaagatcccctggagaagggaaaggctacccactccagtattctggcctggagaattcca 48072 Query: 419 cggac 423 |||| Sbjct: 48073 tggac 48077 Score = 73.8 bits (37), Expect = 9e-11 Identities = 94/113 (83%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||| ||| |||| |||| | ||| |||||||||||| || ||||| |||||| | Sbjct: 29044 gggaagattccctggaggagggcacggcaacccactccagtgtttttgcctggagaatcc 28985 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 || |||||| |||||||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 28984 catggacagaggagcctggcagcctatagtccatagggttgcacagagttgga 28932 Score = 71.9 bits (36), Expect = 4e-10 Identities = 78/92 (84%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 ||||||||||||||||||| ||| |||| |||| | ||||||| |||||||||| | Sbjct: 3536 aaagaatctgcctgcaatgtgggagaccccggtttgattcctgggtcgggaagatccact 3477 Query: 370 ggagaagggaatggctacccactccagtattc 401 ||||||| || |||||||||||||||||||| Sbjct: 3476 ggagaagagataggctacccactccagtattc 3445 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 48619 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 48560 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 48559 gcctggtgggct 48548 Score = 71.9 bits (36), Expect = 4e-10 Identities = 110/132 (83%), Gaps = 2/132 (1%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||| |||||||||||||||||| ||| ||| ||||||| | |||||| |||||||| Sbjct: 55690 atggtgaagaatctgcctgcaatgtgggagacctgggttcaatgtctgggttgggaagat 55631 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggac 423 | | |||| ||| ||||| |||||||||||||||| ||||| |||||| ||| |||| Sbjct: 55630 -ctctggaggggggcatggcaacccactccagtattcttgcctggagaatccccatggac 55572 Query: 424 aggggagcctgg 435 || ||||||||| Sbjct: 55571 agaggagcctgg 55560 Score = 69.9 bits (35), Expect = 1e-09 Identities = 86/103 (83%) Strand = Plus / Plus Query: 346 gtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgc 405 |||||||||| ||| |||||||| |||| ||| |||||| ||| ||||||| || ||| Sbjct: 70674 gtccctgggtcgggcagatcccctggaggaggaaatggcaacctgctccagtgttgttgc 70733 Query: 406 ctagagaataccacggacaggggagcctggcgggctacagtcc 448 || | ||| || ||||||||||||||||||||||||||||| Sbjct: 70734 ctgggaaatcccttggacaggggagcctggcgggctacagtcc 70776 Score = 69.9 bits (35), Expect = 1e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||| | |||||||| ||| ||||||||||| |||||||||||||||||||| Sbjct: 72422 tccctggattgggaagataccctggagaagggaaaggctacccactccagtattc 72368 Score = 67.9 bits (34), Expect = 6e-09 Identities = 97/118 (82%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| |||||| ||||||| | |||| || Sbjct: 3421 tggtaaagaatccacctgcaatgtgggagacctgggttcgatccctggattgggacagtc 3362 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| ||||| |||||||||||||| |||| |||||| ||| |||| Sbjct: 3361 ccctggagaagggaaaggctatccactccagtattctggcctggagaattccatggac 3304 Score = 67.9 bits (34), Expect = 6e-09 Identities = 115/142 (80%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| |||||| || | |||| |||| ||||| |||||||||||||| Sbjct: 75434 ggttcaatccctgggttgggaagtgcctctggaggagggcatggcaacccactccagtat 75375 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || ||||| ||||| ||| |||| ||||| ||| |||||| | ||| |||||| | Sbjct: 75374 tcttgcctgaagaatcccatggaccaaggagcttggtgggctaaaatccatagggtcaca 75315 Query: 460 aagagttggatacaactgaagc 481 |||||| ||| ||||||||||| Sbjct: 75314 aagagtcggacacaactgaagc 75293 Score = 65.9 bits (33), Expect = 2e-08 Identities = 48/53 (90%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||| |||||||||| | |||||||||| |||||||||||||||||||| Sbjct: 47885 cctgggttgggaagatccactggagaagggataggctacccactccagtattc 47937 Score = 63.9 bits (32), Expect = 9e-08 Identities = 95/116 (81%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||| || |||||||||||| ||| ||||| |||||| ||| |||| |||| Sbjct: 50668 ggagaaggaaatagcaacccactccagtgttcttgcctggagaatcccagggactcggga 50727 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| || |||||| | ||||| ||| | |||||||||||| Sbjct: 50728 gcctggtgggctgccgtctctggggttgcacagagtcggacatgactgaagcgact 50783 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 67959 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggtgga 67900 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 67899 gcctggtgggct 67888 Score = 63.9 bits (32), Expect = 9e-08 Identities = 95/116 (81%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||||||||| ||| || | ||| | Sbjct: 97588 ggagaaggaaatggcaacccactccagtgttcttgcctagagaaccccagggccggggaa 97647 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||||| | ||||| ||| || |||||||||||| Sbjct: 97648 gcctggtgggctgccgtctatggggttgcacagagtcggacacgactgaagcgact 97703 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 55438 ggagaaggaaatggcagcccactccagtgttcttgcctggagaatcccagggacggggga 55379 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 55378 gcctggtgggct 55367 Score = 58.0 bits (29), Expect = 5e-06 Identities = 56/65 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| || ||||| |||||| ||| |||| ||||| Sbjct: 33511 ggagaaggcaatggcaccccactccagtactcttgcctggagaatcccagggacggggga 33452 Query: 430 gcctg 434 ||||| Sbjct: 33451 gcctg 33447 >gb|CM000183| Bos taurus chromosome 7-FRAG[58950000,59049999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 153/174 (87%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| ||| ||||||| ||||||||| ||||||||||| Sbjct: 85120 gtaaagaatctgcctgcaatgcaggagacctgggttcaatccctgggttgggaagatccc 85061 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||| |||||||||||||||||||||||| ||||| ||||| ||| |||||| | Sbjct: 85060 ctggagaagagaatggctacccactccagtattcttgcctggagaaccccatggacagag 85001 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagc 481 |||||||| ||||||||| || ||||| | ||||||||||| ||| ||||||| Sbjct: 85000 gagcctggtgggctacagcccacagggtggcaaagagttggacacagctgaagc 84947 Score = 121 bits (61), Expect = 4e-25 Identities = 91/101 (90%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||| |||||| |||||||||||||||||||||||||||||||| |||| Sbjct: 58034 tccctgggttgggacaatcccctggagaagggaatggctacccactccagtattcttgcc 57975 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtc 447 | |||||| ||| |||||| ||||||||| ||||||||||| Sbjct: 57974 tggagaattccatggacagaggagcctggtgggctacagtc 57934 Score = 113 bits (57), Expect = 1e-22 Identities = 96/109 (88%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || |||||||||||| |||| |||||||||| ||||||| |||||||| |||| Sbjct: 31315 tccctgagttgggaagatcccctggagtagggaatggcaacccacttcagtattcttgcc 31256 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggt 455 | |||||| ||| |||||| |||||||||| ||||||||||||| |||| Sbjct: 31255 tggagaattccatggacagaggagcctggcaggctacagtccctggggt 31207 Score = 105 bits (53), Expect = 3e-20 Identities = 83/93 (89%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||| ||||| ||| ||| ||||||| ||||||||| ||||||||| Sbjct: 20436 tggtaaagaatccacctgtaatgcaggagacctgggttcaatccctgggttgggaagatc 20495 Query: 366 ccccggagaagggaatggctacccactccagta 398 ||| ||||||||||| ||||||||||||||||| Sbjct: 20496 ccctggagaagggaaaggctacccactccagta 20528 Score = 99.6 bits (50), Expect = 2e-18 Identities = 112/130 (86%), Gaps = 2/130 (1%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||||| || ||||| || ||| ||| |||||| ||| Sbjct: 42015 ggagaaggcaatggccacccactccagtactcttgcctggaaaatcccatggacagagga 42074 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgactcaca 489 |||||| ||||| |||||| | |||||| ||||||||||| ||||||| ||||||| || Sbjct: 42075 gcctggtgggctgcagtccatggggttgcaaagagttggacacaactg-agcgact-tca 42132 Query: 490 ctttcacttt 499 |||||||||| Sbjct: 42133 ctttcacttt 42142 Score = 83.8 bits (42), Expect = 9e-14 Identities = 69/78 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||| ||||| Sbjct: 45131 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccagggacggggga 45190 Query: 430 gcctggcgggctacagtc 447 |||||| ||||| ||||| Sbjct: 45191 gcctggtgggctgcagtc 45208 Score = 83.8 bits (42), Expect = 9e-14 Identities = 102/122 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| | ||||||||| ||| ||| |||||||| ||| || | Sbjct: 74857 tccctgggtttggaagatcccctgaagaagggaaaggcaacctactccagtgttcttgtc 74798 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| ||||||||| |||||| ||||| ||| ||| |||||||| Sbjct: 74797 tggagaatcccatggacagaggagcctggtgggctatagtccacaggattgcaaagagtt 74738 Query: 467 gg 468 || Sbjct: 74737 gg 74736 Score = 73.8 bits (37), Expect = 9e-11 Identities = 67/77 (87%) Strand = Plus / Plus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 |||||||||||||||||| |||||||||||| |||| ||| || | | |||||||||||| Sbjct: 87378 cgggttcagtccctgggttgggaagatcccctggaggaggaaaagacaacccactccagt 87437 Query: 398 attcatgcctagagaat 414 |||| | ||| |||||| Sbjct: 87438 attcttacctggagaat 87454 Score = 73.8 bits (37), Expect = 9e-11 Identities = 100/121 (82%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||| |||||||||||||||| |||||||| ||| |||||| ||||| |||||| || Sbjct: 47017 ggaagataccccggagaagggaatagctacccattccggtattcttgcctggagaattcc 46958 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactg 477 | ||| || |||||||| ||| ||||||| ||||| ||||||||||| | ||||| Sbjct: 46957 atggatagaagagcctggtaggccacagtccacagggtcacaaagagttggacaaaactg 46898 Query: 478 a 478 | Sbjct: 46897 a 46897 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| || ||||| |||||| ||| |||||||||| Sbjct: 35469 ggagaaggaaatggcgacccactccagtgttgttgcctggagaatcccagggacagggga 35410 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 35409 gcctggtgggct 35398 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 83783 ggagaaggcaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 83724 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 83723 gcctggtgggct 83712 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 91583 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 91524 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 91523 gcctggtgggct 91512 Score = 63.9 bits (32), Expect = 9e-08 Identities = 56/64 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||| | |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 1406 ggagaaggaaatgacaacccactccagtattcttgcctggagaatcccagggacagagga 1347 Query: 430 gcct 433 |||| Sbjct: 1346 gcct 1343 Score = 63.9 bits (32), Expect = 9e-08 Identities = 71/84 (84%) Strand = Plus / Plus Query: 351 tgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctaga 410 ||||| |||||||||||| |||||||| |||||| |||| |||||||||| ||| || Sbjct: 77761 tgggttgggaagatcccctggagaaggaaatggcaaccccgtccagtattcttgctggga 77820 Query: 411 gaataccacggacaggggagcctg 434 |||| ||| |||||| |||||||| Sbjct: 77821 gaatcccatggacagaggagcctg 77844 >gb|CM000180| Bos taurus chromosome 4-FRAG[90720000,90819999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 148/166 (89%), Gaps = 1/166 (0%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaa-acccgggttcagtccctgggtggggaaga 363 ||||||| ||||||||||||||||| |||| ||||||||||| ||||||||| ||||||| Sbjct: 50298 atggtaaggaatctgcctgcaatgcaggaagacccgggttcaatccctgggtcgggaaga 50357 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 |||||| ||||||||| ||||||||||||||||||||| ||||| |||||| || |||| Sbjct: 50358 tccccccgagaagggattggctacccactccagtattcttgcctggagaattccgtggac 50417 Query: 424 aggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 || |||||||||| |||| |||||| | |||||| ||||||||||| Sbjct: 50418 agaggagcctggcaggctgcagtccatggggttgcaaagagttgga 50463 Score = 117 bits (59), Expect = 7e-24 Identities = 116/135 (85%) Strand = Plus / Minus Query: 314 aatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggag 373 |||||||||||||||| ||| ||| ||||| ||||||||| |||||||| || |||| Sbjct: 97293 aatctgcctgcaatgcaggagacctgggtttgatccctgggtcaggaagatctcctggag 97234 Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 ||||||||||| ||| ||||||||||| ||||| |||||| ||| |||||| ||||||| Sbjct: 97233 aagggaatggcaacctgctccagtattcttgcctggagaatcccatggacagaggagcct 97174 Query: 434 ggcgggctacagtcc 448 ||| ||||||||||| Sbjct: 97173 ggccggctacagtcc 97159 Score = 113 bits (57), Expect = 1e-22 Identities = 96/109 (88%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||| ||| ||||||| ||| |||||||| |||||| |||||||||||||| Sbjct: 55492 ggttcaatcccttggtcaggaagatgccctggagaaggaaatggcaacccactccagtat 55551 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 || ||||| ||||| ||| ||||||||||||||||||||||||||||| Sbjct: 55552 tcttgcctggagaaccccatggacaggggagcctggcgggctacagtcc 55600 Score = 109 bits (55), Expect = 2e-21 Identities = 115/135 (85%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| | ||||||||||||| ||| | |||||||| Sbjct: 52256 gtaaagaatctgcctgcaatgcaggagatgtgggttcagtccctcggtcagaaagatccc 52315 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||||||||||| | ||| ||||||||| ||||| ||| || ||| |||||| | Sbjct: 52316 ctggagaagggaatggcaatgcacaccagtattcttgcctggaggattccatggacagag 52375 Query: 428 gagcctggcgggcta 442 ||||||||||||||| Sbjct: 52376 gagcctggcgggcta 52390 Score = 91.7 bits (46), Expect = 4e-16 Identities = 76/86 (88%) Strand = Plus / Plus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 ||||||| |||||| ||| |||| |||||| ||||||||| ||||||||| || |||||| Sbjct: 98648 tctgcctacaatgcaggagacccaggttcaatccctgggttgggaagatctcctggagaa 98707 Query: 376 gggaatggctacccactccagtattc 401 || |||||| |||||||||||||||| Sbjct: 98708 ggaaatggcaacccactccagtattc 98733 Score = 81.8 bits (41), Expect = 4e-13 Identities = 68/77 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||||| |||| |||||||||||||||| ||||| ||||| ||| |||||| ||| Sbjct: 72103 ggagaagggagtggcaacccactccagtattcttgcctggagaaccccatggacagagga 72162 Query: 430 gcctggcgggctacagt 446 |||||| |||||||||| Sbjct: 72163 gcctggtgggctacagt 72179 Score = 79.8 bits (40), Expect = 1e-12 Identities = 116/140 (82%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| | |||||||||| |||| |||| ||||| ||| |||||| ||||| Sbjct: 96189 ttcaatccctgggtcgcgaagatcccctggaggagggcatggcaaccgactccaatattc 96130 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaa 461 |||| ||||||| ||| |||||| | |||||| || ||||||||| ||||||| ||| Sbjct: 96129 ttgcccagagaatcccatggacagagaagcctgttgg-ctacagtccacagggttgcaaa 96071 Query: 462 gagttggatacaactgaagc 481 |||| || ||||||||||| Sbjct: 96070 gagtcagacacaactgaagc 96051 Score = 73.8 bits (37), Expect = 9e-11 Identities = 70/81 (86%) Strand = Plus / Plus Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 |||||||||| |||||| |||||||||||| || |||||||| ||| ||| |||||| | Sbjct: 76931 ccggagaaggcaatggcaccccactccagtactcttgcctagaaaatcccagggacagag 76990 Query: 428 gagcctggcgggctacagtcc 448 |||||||| ||||| |||||| Sbjct: 76991 gagcctggtgggctgcagtcc 77011 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 59309 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 59250 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 59249 gcctggtgggct 59238 Score = 67.9 bits (34), Expect = 6e-09 Identities = 79/94 (84%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||| |||||| |||||| ||| || |||||||| | ||| ||| ||||||||||| Sbjct: 70808 gtaaagaacctgcctacaatgcaggagactcgggttcaattccttggtcgggaagatccc 70749 Query: 368 ccggagaagggaatggctacccactccagtattc 401 || |||||| ||| | |||||||||||||||| Sbjct: 70748 ttggggaagggcatgacaacccactccagtattc 70715 Score = 61.9 bits (31), Expect = 3e-07 Identities = 97/119 (81%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| | |||||| ||| ||||||| |||||| |||||||||||||||| ||| Sbjct: 71311 tccctgggttgacaagatctcccagagaaggaaatggcaacccactccagtattcttgct 71252 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 || ||| ||| |||||| |||| ||||| || || |||| | |||||||||||||| Sbjct: 71251 gggaaaatcccatggacagaggagactggcagggtatggtccatggggttgaaaagagt 71193 Score = 58.0 bits (29), Expect = 5e-06 Identities = 44/49 (89%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggt 355 |||||| |||||||||||||||| |||||| | |||||| ||||||||| Sbjct: 72052 ggtaaaaaatctgcctgcaatgcaggaaactcaggttcaatccctgggt 72100 >gb|CM000180| Bos taurus chromosome 4-FRAG[64440000,64539999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 147/166 (88%) Strand = Plus / Minus Query: 304 aatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaaga 363 ||||||||||||||||||||||||| ||| ||| ||||||| ||||||||| ||||||| Sbjct: 34189 aatggtaaagaatctgcctgcaatgtgggagaccagggttcaatccctgggttgggaaga 34130 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| |||||||||| ||||||||||||||||||||| ||||| |||| | ||| |||| Sbjct: 34129 tcccctggagaagggactggctacccactccagtattcttgcctggagagttccatggac 34070 Query: 424 aggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 || |||||||||| ||||||||||| | |||||| |||||| |||| Sbjct: 34069 agaggagcctggcaggctacagtccatggggttgcaaagagctgga 34024 Score = 115 bits (58), Expect = 3e-23 Identities = 142/170 (83%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||| ||||||||||||||| ||| ||| ||||| ||||||||| || ||||||||| Sbjct: 51471 taaagcatctgcctgcaatgcaggagacctgggtttgatccctgggtcggaaagatcccc 51412 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| ||| | | Sbjct: 51411 tggagaaggaaatggcaacccactccagtattcttgcctggagaatcccatggatggaag 51352 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 ||||||| |||||||||||| ||||| | ||||||| ||| || ||||| Sbjct: 51351 agcctggtgggctacagtccacagggtcgcaaagagtcggacacgactga 51302 Score = 107 bits (54), Expect = 6e-21 Identities = 106/122 (86%), Gaps = 1/122 (0%) Strand = Plus / Minus Query: 316 tctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaa 375 |||||||||||||| ||| |||||||||| ||||||||| || ||||||||| |||||| Sbjct: 35066 tctgcctgcaatgcaggagacccgggttcgatccctgggttggaaagatcccctggagaa 35007 Query: 376 gggaatggctacccactccagtattc-atgcctagagaataccacggacaggggagcctg 434 || |||||| |||||||||||||||| |||| |||||| ||| |||||| |||||||| Sbjct: 35006 ggaaatggcaacccactccagtattctttgcccggagaatcccatggacagaggagcctg 34947 Query: 435 gc 436 || Sbjct: 34946 gc 34945 Score = 105 bits (53), Expect = 3e-20 Identities = 122/145 (84%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||||||||||||| |||||||||||| | || |||| |||| ||||||||||||||| Sbjct: 37288 gttcagtccctgggttgggaagatcccctgcaggagggcgtggcaacccactccagtatt 37347 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaa 460 | || || ||||| ||| | ||| |||||||||||||||||||||| |||||| | Sbjct: 37348 cttggctggagaaacccattgtcagaggagcctggcgggctacagtccatagggtcacac 37407 Query: 461 agagttggatacaactgaagcgact 485 ||| ||||| ||||||||||||||| Sbjct: 37408 agaattggacacaactgaagcgact 37432 Score = 93.7 bits (47), Expect = 1e-16 Identities = 83/95 (87%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |||| Sbjct: 21005 ggttcagtccctgggttgggaagatcccctggagaagggaatggctacctactctagtac 21064 Query: 400 tcatgcctagagaataccacggacaggggagcctg 434 || | ||| |||||| ||| ||| || |||||||| Sbjct: 21065 tctttcctggagaattccatggatagaggagcctg 21099 Score = 91.7 bits (46), Expect = 4e-16 Identities = 106/126 (84%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||| |||| ||||| |||||| ||||||| ||||||||| || |||||| Sbjct: 8123 gtaaagaatccacctgtaatgcaggaaactagggttcaatccctgggtcagggagatcct 8182 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||||||||||||||| ||| ||||||| ||||| |||||| || |||||| | Sbjct: 8183 ctggagaagggaatggctaccctctctagtattcttgcctggagaatttcatggacagag 8242 Query: 428 gagcct 433 |||||| Sbjct: 8243 gagcct 8248 Score = 85.7 bits (43), Expect = 2e-14 Identities = 79/91 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| |||||| ||||||||| |||||||| Sbjct: 56326 tggtaaagaatccacctgcaatgtgggagacctgggttcgatccctgggttaggaagatc 56385 Query: 366 ccccggagaagggaatggctacccactccag 396 ||| ||||||||||| ||||||||||||||| Sbjct: 56386 ccctggagaagggaaaggctacccactccag 56416 Score = 83.8 bits (42), Expect = 9e-14 Identities = 122/148 (82%), Gaps = 3/148 (2%) Strand = Plus / Minus Query: 304 aatggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaaga 363 ||||||||||||||||| |||||||| | | ||| ||||| || || ||| | ||||| Sbjct: 81129 aatggtaaagaatctgcttgcaatgcagaacaccagggtttgatctctaggtagcgaaga 81070 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctag---agaataccacg 420 | |||| ||||| |||||||| |||||||||||||||| ||||| | ||||| ||| | Sbjct: 81069 tacccctgagaaaggaatggcaacccactccagtattcttgcctggacaagaattccatg 81010 Query: 421 gacaggggagcctggcgggctacagtcc 448 ||||| |||| |||| |||||||||||| Sbjct: 81009 gacagaggagtctggtgggctacagtcc 80982 Score = 77.8 bits (39), Expect = 6e-12 Identities = 114/139 (82%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| | || | || ||||| ||||||||||||||| | | Sbjct: 3736 tccctgggtcaggaagatcccctgaaggaaggcatggcaacccactccagtatttttact 3677 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | |||||| ||| |||||| ||||| ||| |||||||||||| |||||| | | |||||| Sbjct: 3676 tggagaatcccaaggacagaggagcgtggtgggctacagtccatagggtcgcacagagtt 3617 Query: 467 ggatacaactgaagcgact 485 ||| || ||||||| |||| Sbjct: 3616 ggacactactgaagtgact 3598 Score = 77.8 bits (39), Expect = 6e-12 Identities = 99/119 (83%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||| |||||| |||||||| |||||| | |||||||||||||| |||| Sbjct: 79355 tccctgggttaggaaaatcccctggagaaggaaatggcaatccactccagtattcttgcc 79296 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| ||| ||||| ||| |||| |||||||||||| | |||| | ||||||| Sbjct: 79295 tggagaattccagggacaaaggaatctggtgggctacagtccatggggtggcaaagagt 79237 Score = 75.8 bits (38), Expect = 2e-11 Identities = 77/90 (85%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 |||||||| || |||| |||| ||||| |||||||||||||||| ||||| ||| || || Sbjct: 95846 ggaagatctcctggagcagggcatggcaacccactccagtattcttgcctggagtatccc 95787 Query: 418 acggacaggggagcctggcgggctacagtc 447 | |||| | ||||||||| ||||||||||| Sbjct: 95786 atggacggaggagcctggtgggctacagtc 95757 Score = 73.8 bits (37), Expect = 9e-11 Identities = 100/121 (82%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| |||| ||||| |||||||||||| ||| |||| |||||| || Sbjct: 45048 ggaagatcccctggaggagggcatggcaacccactccagttttctagcctggagaatccc 44989 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactg 477 ||||| ||| ||||| ||||||||||| | |||| | ||||||||||| ||||||| Sbjct: 44988 catgacagaggactctggcaggctacagtccatggggtcgcaaagagttggacacaactg 44929 Query: 478 a 478 | Sbjct: 44928 a 44928 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 20645 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 20704 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 20705 gcctggtgggct 20716 Score = 65.9 bits (33), Expect = 2e-08 Identities = 90/109 (82%) Strand = Plus / Minus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||| ||| |||| |||| ||||| | |||||||||| ||| | | |||||| | Sbjct: 72557 gggaagattccctggaggagggcatggcaatccactccagtgttctttgttggagaatcc 72498 Query: 417 cacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 || |||||| |||||||||| ||||||||||| |||||| | ||||||| Sbjct: 72497 caaggacagaggagcctggctggctacagtccatagggtagcaaagagt 72449 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 41710 ggagaaggaaatggcagcccactccagtgttcttgcctggagaatcccagggacagggga 41651 Query: 430 gcctggcgggct 441 ||| || ||||| Sbjct: 41650 gccgggtgggct 41639 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||| |||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 80432 ggagaaggaaatggcaacccagtccagtgttcttgcctggagaatcccagggacggggga 80373 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 80372 gcctggtgggct 80361 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| || ||||||||| Sbjct: 18285 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccggggacaggggg 18344 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 18345 gcctggtgggct 18356 Score = 61.9 bits (31), Expect = 3e-07 Identities = 79/95 (83%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| ||| |||||| ||| |||| |||| | ||||||| ||||||||| Sbjct: 56208 ggtaaagaatccacctacaatgcaggagaccccagttcgattcctgggtcaggaagatcc 56267 Query: 367 cccggagaagggaatggctacccactccagtattc 401 || |||||||| | |||||||||||||||||||| Sbjct: 56268 cctggagaaggtataggctacccactccagtattc 56302 Score = 61.9 bits (31), Expect = 3e-07 Identities = 49/55 (89%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 ||||||||| ||||| ||||| |||||||| |||||| |||||||||||||||| Sbjct: 6055 tccctgggtcaggaaggtcccctggagaaggaaatggcaacccactccagtattc 6109 Score = 60.0 bits (30), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||| ||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 27094 ggagaaggaaatggcaacccactctagtgttcttgcctggagaatcccagggacggggga 27153 Query: 430 gcctgg 435 |||||| Sbjct: 27154 gcctgg 27159 Score = 58.0 bits (29), Expect = 5e-06 Identities = 56/65 (86%) Strand = Plus / Plus Query: 378 gaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcg 437 ||||||| | |||||||||||||| ||||| |||||| ||| |||||| ||| ||||| | Sbjct: 15176 gaatggcaatccactccagtattcttgcctggagaattccatggacagaggatcctggtg 15235 Query: 438 ggcta 442 ||||| Sbjct: 15236 ggcta 15240 >gb|CM000204| Bos taurus chromosome 28-FRAG[3780000,3879999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 147/166 (88%) Strand = Plus / Minus Query: 314 aatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggag 373 |||||||||||||||| ||| ||||||||||| ||||| || |||||||||||| |||| Sbjct: 30596 aatctgcctgcaatgcaggagacccgggttcaacccctgagttgggaagatcccctggag 30537 Query: 374 aagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcct 433 |||||||||||||||||||||||||||| ||||| |||||| ||| |||||| |||| || Sbjct: 30536 aagggaatggctacccactccagtattcttgcctggagaattccatggacagaggagtct 30477 Query: 434 ggcgggctacagtccctagggttgaaaagagttggatacaactgaa 479 |||| |||||||||| | |||| | ||||||||||| ||||||||| Sbjct: 30476 ggcgagctacagtccttggggtcgcaaagagttggacacaactgaa 30431 Score = 141 bits (71), Expect = 5e-31 Identities = 126/143 (88%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaa-acccgggttcagtccctgggtggggaaga 363 |||||||||||||||||||||||| ||||| |||| |||| ||||| || ||||||| Sbjct: 21568 atggtaaagaatctgcctgcaatggtggaagacccaggtttgacccctgagttgggaaga 21509 Query: 364 tcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||||| ||||||||||| |||||||||||||||||||| ||||| |||||| ||| |||| Sbjct: 21508 tcccctggagaagggaaaggctacccactccagtattcttgcctggagaattccatggac 21449 Query: 424 aggggagcctggcgggctacagt 446 || ||||||||| |||||||||| Sbjct: 21448 agaggagcctggtgggctacagt 21426 Score = 107 bits (54), Expect = 6e-21 Identities = 120/142 (84%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||| ||||||||||||| ||| || ||||| | | ||||||| ||||||||| Sbjct: 43269 ggtaaagaacctgcctgcaatgcaggagacttgggtttaattcctgggtcaggaagatcc 43210 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagg 426 || |||||||| |||||| |||||||||||||||| ||| | |||||| ||| ||| || Sbjct: 43209 cctggagaaggaaatggcaacccactccagtattcttgcttggagaatcccatggataga 43150 Query: 427 ggagcctggcgggctacagtcc 448 |||||||| |||||||||||| Sbjct: 43149 agagcctggtgggctacagtcc 43128 Score = 103 bits (52), Expect = 1e-19 Identities = 88/100 (88%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| |||||||| |||||| |||||||||||||||| ||||| Sbjct: 50440 cctgggttgggaagatcccctggagaaggaaatggcaacccactccagtattcttgcctg 50499 Query: 409 gagaataccacggacaggggagcctggcgggctacagtcc 448 || | | ||| |||||| ||||||||| |||||||||||| Sbjct: 50500 gaaagtcccatggacagaggagcctggtgggctacagtcc 50539 Score = 103 bits (52), Expect = 1e-19 Identities = 109/128 (85%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||||||| ||| |||| |||| ||||||||| |||||||||||| Sbjct: 36876 taaagaatctgcctgcaatgcgggagacccaggtttgatccctgggtagggaagatcccc 36935 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||| |||||||||||| ||||||||||||| ||||| || ||| || ||| || || Sbjct: 36936 tggaggagggaatggctatgcactccagtattcttgcctggaaaattccgtggagagagg 36995 Query: 429 agcctggc 436 |||||||| Sbjct: 36996 agcctggc 37003 Score = 93.7 bits (47), Expect = 1e-16 Identities = 104/123 (84%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || |||||||||||| ||| ||| | ||| |||||||||||||||| |||| Sbjct: 59439 tccctgtgtcgggaagatcccctggaataggaagcggcaacccactccagtattcttgcc 59380 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | || ||| ||| |||||| |||||||||||||||||||||| | ||||| |||||||| Sbjct: 59379 tggaaaatcccatggacagaggagcctggcgggctacagtccatgaggttgcaaagagtt 59320 Query: 467 gga 469 ||| Sbjct: 59319 gga 59317 Score = 91.7 bits (46), Expect = 4e-16 Identities = 88/102 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| | |||||||||| ||| ||| |||||| |||||||||||||||| |||| Sbjct: 53804 tccctgggtcgagaagatcccctggaataggaaatggcaacccactccagtattcttgcc 53863 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| || |||||| ||||||||| |||||||||||| Sbjct: 53864 tggagaattccctggacagaggagcctggagggctacagtcc 53905 Score = 91.7 bits (46), Expect = 4e-16 Identities = 88/102 (86%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||| |||||||||||| |||| |||| ||| | ||||||| |||||||| |||| Sbjct: 25731 tccctgggctgggaagatcccctggaggagggcatgacaacccactgcagtattcttgcc 25790 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | |||||| ||| |||||| ||||||||| |||||||||||| Sbjct: 25791 tggagaatcccatggacagaggagcctggtgggctacagtcc 25832 Score = 89.7 bits (45), Expect = 2e-15 Identities = 99/117 (84%) Strand = Plus / Minus Query: 318 tgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaagg 377 |||||||||||| ||| ||| ||||| | ||||||| |||| |||||| |||||||| Sbjct: 1410 tgcctgcaatgcaggagacctgggtttgattcctgggtcaggaaaatcccctggagaagg 1351 Query: 378 gaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctg 434 |||||| |||||||||||||||| ||||| |||||| ||| |||||| |||||||| Sbjct: 1350 aaatggcaacccactccagtattcttgcctggagaatcccatggacagaggagcctg 1294 Score = 87.7 bits (44), Expect = 6e-15 Identities = 110/132 (83%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || ||||||||| || |||||||| |||||| |||||||||||||||| ||| Sbjct: 57557 tccctgtgttgggaagatctcctggagaaggaaatggcaacccactccagtattctggcc 57616 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 | | ||| ||| |||||| ||||||||| ||| ||||||| | |||||||||||||| Sbjct: 57617 tgggaaatcccaaggacagaggagcctggaaggccacagtccatggggttgaaaagagtc 57676 Query: 467 ggatacaactga 478 ||| || ||||| Sbjct: 57677 ggacacgactga 57688 Score = 87.7 bits (44), Expect = 6e-15 Identities = 120/143 (83%), Gaps = 3/143 (2%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 |||||||||||||||||||||| ||| ||| | ||||| || ||||| |||||||||| Sbjct: 37233 ggtaaagaatctgcctgcaatgtgggagacctgagttcaatc--tgggttgggaagatcc 37290 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaat-accacggacag 425 | |||| |||| ||||| |||||||||||||||| ||||| ||||| ||| |||||| Sbjct: 37291 catggaggagggcatggcaacccactccagtattcttgcctgaagaatccccatggacag 37350 Query: 426 gggagcctggcgggctacagtcc 448 || ||||||| ||||||||||| Sbjct: 37351 aggggcctggcaggctacagtcc 37373 Score = 81.8 bits (41), Expect = 4e-13 Identities = 80/93 (86%) Strand = Plus / Plus Query: 315 atctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggaga 374 ||||| ||||||||| | | |||| |||||| ||||||||| |||||||||||| ||||| Sbjct: 42089 atctgtctgcaatgcagaagacccaggttcaatccctgggttgggaagatcccctggaga 42148 Query: 375 agggaatggctacccactccagtattcatgcct 407 ||| | |||| ||||||||||||||| ||||| Sbjct: 42149 aggaagtggcagcccactccagtattcttgcct 42181 Score = 81.8 bits (41), Expect = 4e-13 Identities = 86/101 (85%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||||| ||||||||||| |||| |||| || || |||| ||||||||||| || | Sbjct: 31409 tccctgggtgaggaagatcccctggaggagggcatagcaaccctctccagtattcttgtc 31350 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtc 447 | |||| | ||| |||||| ||||||||| ||||||||||| Sbjct: 31349 tggagattcccatggacagaggagcctggtgggctacagtc 31309 Score = 81.8 bits (41), Expect = 4e-13 Identities = 74/85 (87%) Strand = Plus / Minus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| |||||||||||| |||||| |||| | ||||||||||||||| Sbjct: 27106 gggttcaatccctgggttgggaagatcccctggagaaaggaaagtctacccactccagta 27047 Query: 399 ttcatgcctagagaataccacggac 423 ||| |||| |||||| ||| |||| Sbjct: 27046 ttctggcctggagaattccatggac 27022 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| ||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 8197 ggagaaggaaatggaaacccactccagtgttcttgcctggagaatcccagggacagggga 8138 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 8137 gcctggtgggct 8126 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 3312 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 3371 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 3372 gcctggtgggct 3383 Score = 69.9 bits (35), Expect = 1e-09 Identities = 92/111 (82%) Strand = Plus / Minus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 |||||||||||||| ||| ||||||| ||| |||| |||| ||||| |||||||||| | Sbjct: 35535 cgggttcagtccctcggtctggaagatgccctggaggagggcatggccacccactccaat 35476 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 |||| ||||| ||||| ||| |||||| || ||| || ||||||||||| Sbjct: 35475 attcttgcctggagaaacccatggacagaggcacctcgcaggctacagtcc 35425 Score = 69.9 bits (35), Expect = 1e-09 Identities = 77/91 (84%) Strand = Plus / Minus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| ||| |||| |||||| |||||| |||| ||| ||||| | ||| || Sbjct: 24795 ggaagatcccctggaaaaggaaatggcaacccacatcagtgttcttgcctgggaaatccc 24736 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| |||||||||||||||||||||| Sbjct: 24735 atggacagaggagcctggcgggctacagtcc 24705 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 29683 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggcgga 29742 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 29743 gcctggtgggct 29754 Score = 61.9 bits (31), Expect = 3e-07 Identities = 67/79 (84%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| ||||||||| ||| |||||||||| ||||| |||| Sbjct: 25521 tccctgggtcaggaagatcccctggagaagggcatgataacccactccaatattcttgcc 25580 Query: 407 tagagaataccacggacag 425 | |||||| ||| |||||| Sbjct: 25581 tggagaatcccatggacag 25599 Score = 61.9 bits (31), Expect = 3e-07 Identities = 67/79 (84%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||||| ||||| ||||||| |||| ||| ||||| |||||| || |||||| ||| Sbjct: 49182 ggagaagggcatggcaacccacttcagttttcttgcctggagaatctcatggacagagga 49241 Query: 430 gcctggcgggctacagtcc 448 ||||| |||||||||||| Sbjct: 49242 gcctgatgggctacagtcc 49260 Score = 60.0 bits (30), Expect = 1e-06 Identities = 127/158 (80%), Gaps = 1/158 (0%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||| ||||| ||||||| |||||||| |||||| ||||||||| |||| || || Sbjct: 9098 gtaaagcatctgaatgcaatg-tggaaacctgggttcgatccctgggtcaggaatatacc 9156 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | |||||||| |||||| || ||||| ||| || ||| | |||||| ||| |||||| | Sbjct: 9157 ctggagaaggaaatggcaacacactctggtactcgtgcatggagaattccatggacagag 9216 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagt 465 ||| |||| ||||||||||| | ||||| ||||||| Sbjct: 9217 gagtctggtaggctacagtccatggggtttcaaagagt 9254 Score = 58.0 bits (29), Expect = 5e-06 Identities = 41/45 (91%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||| |||||| |||||||||| ||||| |||||||||||| Sbjct: 14450 ggagaaggaaatggcaacccactccattattcttgcctagagaat 14494 >gb|CM000202| Bos taurus chromosome 26-FRAG[27810000,27909999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 170/194 (87%), Gaps = 2/194 (1%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgcaatgctgg-aaacccgggttcagtccctgggtggggaagatc 365 ||||||| ||||||||||||||| || |||||| |||||||||||||||| |||||||| Sbjct: 32116 ggtaaaggatctgcctgcaatgcaggtaaacccaggttcagtccctgggtcaggaagatc 32175 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| ||||||| ||||||| |||||||||||||||| ||||| |||||| ||| |||||| Sbjct: 32176 ccctggagaagagaatggcaacccactccagtattcttgcctggagaattccatggacag 32235 Query: 426 gggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 ||||||||||||||||||||| | |||| | ||||||||||| |||||||| | ||| Sbjct: 32236 aggagcctggcgggctacagtctatggggtggcaaagagttggacccaactgaa-caact 32294 Query: 486 cacactttcacttt 499 ||||||||||||| Sbjct: 32295 aacactttcacttt 32308 Score = 143 bits (72), Expect = 1e-31 Identities = 132/152 (86%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||| |||| | | ||| ||||||||||||||||| ||||||||| Sbjct: 24071 tggtaaagaatccgcctgctatgcggaagacctgggttcagtccctgggttgggaagatc 24130 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 || |||| |||| ||||| |||||||||||||||| |||| |||||| |||||||||| Sbjct: 24131 ccttggaggagggcatggcaacccactccagtattctcgcctggagaatcccacggacag 24190 Query: 426 gggagcctggcgggctacagtccctagggttg 457 ||||||||||||||| |||||| | |||||| Sbjct: 24191 aggagcctggcgggctgcagtccatggggttg 24222 Score = 129 bits (65), Expect = 2e-27 Identities = 137/161 (85%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||| ||||||| ||| ||| ||||| ||||||| | |||||||| ||| Sbjct: 89049 taaagaatctgcccgcaatgcaggagacctgggtttgatccctggattgggaagattccc 88990 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||||||||||||||||||||||||| |||||| ||||| |||||| ||| |||||| || Sbjct: 88989 tggagaagggaatggctacccactccggtattcttgcctggagaatcccatggacagagg 88930 Query: 429 agcctggcgggctacagtccctagggttgaaaagagttgga 469 ||||||| ||||| ||||| | |||||| |||||| |||| Sbjct: 88929 agcctggtgggctgcagtctatggggttgcaaagagctgga 88889 Score = 101 bits (51), Expect = 4e-19 Identities = 121/143 (84%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccggg-ttcagtccctgggtggggaagatc 365 ||||||||||||||||||||||| | ||| || | |||| ||||||||| |||||||| Sbjct: 43940 ggtaaagaatctgcctgcaatgcagtaaatcctgtattcaatccctgggtcaggaagatc 43881 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| ||| ||||||||| ||||||||| |||||||| ||||| |||||| ||| || ||| Sbjct: 43880 ccctggaaaagggaatgtctacccactgcagtattcctgcctggagaattccatgggcag 43821 Query: 426 gggagcctggcgggctacagtcc 448 |||||||| ||||||| |||| Sbjct: 43820 aggagcctgaagggctacggtcc 43798 Score = 89.7 bits (45), Expect = 2e-15 Identities = 84/97 (86%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| ||| ||| |||| ||||| | ||||||| ||||||| Sbjct: 99592 atggtaaagaatctgcctgcagtgcaggagacccaggttcgattcctgggtcaggaagat 99533 Query: 365 cccccggagaagggaatggctacccactccagtattc 401 |||| | |||||||||||||| | ||||||||||||| Sbjct: 99532 cccctgaagaagggaatggcttctcactccagtattc 99496 Score = 89.7 bits (45), Expect = 2e-15 Identities = 88/101 (87%), Gaps = 1/101 (0%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| ||| ||||||| || |||| |||||||| || Sbjct: 10010 gtaaagaatctgcctgcaatgcaggagacctgggttcaacccttgggatgggaagattcc 9951 Query: 368 cc-ggagaagggaatggctacccactccagtattcatgcct 407 || |||||||| |||||| |||||||||||||||| ||||| Sbjct: 9950 cctggagaaggaaatggcaacccactccagtattcttgcct 9910 Score = 85.7 bits (43), Expect = 2e-14 Identities = 91/107 (85%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||||||||||||| ||| ||| ||||||| | ||||||| | || | |||| Sbjct: 755 gtaaagaatctgcctgcaatgcaggagacctgggttcatttcctgggttgagagggtccc 814 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaat 414 | |||||||| |||||| |||||||||||| || ||||| |||||| Sbjct: 815 ctggagaaggaaatggcagcccactccagtactcttgcctggagaat 861 Score = 79.8 bits (40), Expect = 1e-12 Identities = 64/72 (88%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| |||||||||||| ||| ||| ||||| Sbjct: 67412 ggagaaggaaatggcaacccactccagtattcttgcctagagaatcccagggatggggga 67471 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 67472 gcctggtgggct 67483 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 91449 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 91390 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | ||| | |||| | | ||||| |||||| |||||||||||| Sbjct: 91389 gcctggtgggctgccgtctatggggtcgcacagagtcggatacgactgaagcgact 91334 Score = 79.8 bits (40), Expect = 1e-12 Identities = 97/116 (83%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 3156 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 3215 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| |||| |||||| | |||||| | ||||| ||| || ||||||| |||| Sbjct: 3216 gcctggtaggctgcagtccatggggttgcacagagtcggacacgactgaagtgact 3271 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| ||||| ||| |||||||||| Sbjct: 73957 ggagaaggaaatggcaacccactccagtgttcttgcctggagaaccccagggacagggga 73898 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 73897 gcctggtgggct 73886 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 5773 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 5832 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 5833 gcctggtgggct 5844 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 95438 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 95379 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 95378 gcctggtgggct 95367 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 87512 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 87453 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 87452 gcctggtgggct 87441 Score = 69.9 bits (35), Expect = 1e-09 Identities = 59/67 (88%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 |||||||||||| || ||||||||||| |||||||||||||| |||||| |||||||| Sbjct: 37627 gttcagtccctgagtcaggaagatcccctggagaagggaatggaaacccacaccagtatt 37686 Query: 401 catgcct 407 | ||||| Sbjct: 37687 cttgcct 37693 Score = 67.9 bits (34), Expect = 6e-09 Identities = 79/94 (84%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||| || ||||||||| || ||| ||||||||||| ||||||||| |||| ||| Sbjct: 60324 gtaaaaaaactgcctgcagtgtaggagacccgggttcaatccctgggtcaggaaaatctg 60383 Query: 368 ccggagaagggaatggctacccactccagtattc 401 | |||||||| |||||| |||||||||||||||| Sbjct: 60384 ctggagaaggaaatggccacccactccagtattc 60417 Score = 63.9 bits (32), Expect = 9e-08 Identities = 81/96 (84%), Gaps = 1/96 (1%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| || | ||| || ||||||||||| || || ||||| | Sbjct: 44862 tggtaaagaatctgcctgccaaagtaggagacatgggttcagtccgtgagtctggaaggt 44921 Query: 365 cccccggagaagggaatggctacccactccagtatt 400 |||| |||||||| |||||| ||||||||||||||| Sbjct: 44922 cccctggagaaggaaatggcaacccactccagtatt 44957 Score = 63.9 bits (32), Expect = 9e-08 Identities = 95/116 (81%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| ||||| ||| ||| ||||| Sbjct: 16731 ggagaaggaaatggcaacccactccagtgttcttgcctggagaaccccagggatggggga 16790 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||| ||||| | |||| | |||| | | ||||| ||| || |||||||||||| Sbjct: 16791 gcctggtgggctgccgtcctttgggtcgcacagagtcggacacgactgaagcgact 16846 Score = 61.9 bits (31), Expect = 3e-07 Identities = 67/79 (84%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| || ||||| |||||| ||| |||||| ||| Sbjct: 67269 ggagaaggcaatggcaccccactccagtactcttgcctggagaatcccatggacagagga 67328 Query: 430 gcctggcgggctacagtcc 448 |||||| |||| |||||| Sbjct: 67329 gcctggtaggctgcagtcc 67347 Score = 60.0 bits (30), Expect = 1e-06 Identities = 60/70 (85%) Strand = Plus / Plus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||| |||||| |||||||||||| ||| ||||| |||||| ||| || | ||||||| Sbjct: 85982 agaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggtcgggggagc 86041 Query: 432 ctggcgggct 441 |||| ||||| Sbjct: 86042 ctggtgggct 86051 >gb|CM000199| Bos taurus chromosome 23-FRAG[36180000,36279999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 153/174 (87%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| ||| | ||| ||| ||||||| ||||||||| |||||||| Sbjct: 39006 atggtaaagaatctgcctgtaattcgggagacctgggttcaatccctgggttgggaagat 39065 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||||||||||||||||||| ||||| |||||| || || || Sbjct: 39066 cccctggagaagggaatggctacccactccagtattcttgcctggagaatttcatgggca 39125 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 | |||||||||||||||||||||| | |||| | ||||||| ||| |||||||| Sbjct: 39126 gaggagcctggcgggctacagtccatggggtcgcaaagagtcggacacaactga 39179 Score = 109 bits (55), Expect = 2e-21 Identities = 121/143 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| |||||| ||||||||| | ||||| Sbjct: 28425 atggtaaagaatctgcctgcaatgcaggagaccagggttcgatccctgggtcagaaagat 28484 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||| | |||||| |||||||||||||||| ||||| || ||| ||| ||||| Sbjct: 28485 cccctggagagagaaatggcaacccactccagtattcttgcctggaaaatcccatggaca 28544 Query: 425 ggggagcctggcgggctacagtc 447 | ||| |||||| ||||||||| Sbjct: 28545 gaggaacctggccagctacagtc 28567 Score = 95.6 bits (48), Expect = 2e-17 Identities = 93/108 (86%) Strand = Plus / Minus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| ||||||||||||||||||||| |||||| ||||||| || ||| Sbjct: 3366 ggttcaatccctgggttgggaagatcccccggagaaggaaatggcaacccacttcaatat 3307 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtc 447 || ||||| | |||| || |||| | ||||||||| ||||||||||| Sbjct: 3306 tcttgcctgggaaataacatggactgaggagcctggtgggctacagtc 3259 Score = 93.7 bits (47), Expect = 1e-16 Identities = 116/139 (83%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||| |||||||||| ||| |||| |||||| ||||||||| ||||||| ||| Sbjct: 83709 aaagaatccacctgcaatgcaggagacccaggttcaatccctgggtcaggaagatgccct 83650 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||| | |||||| |||||||||||||||| | ||| | ||| ||| |||||| ||| Sbjct: 83649 ggagaaagaaatggcaacccactccagtattctttcctgggaaatcccatggacagagga 83590 Query: 430 gcctggcgggctacagtcc 448 | ||||| ||||||||||| Sbjct: 83589 gactggcaggctacagtcc 83571 Score = 85.7 bits (43), Expect = 2e-14 Identities = 70/79 (88%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| ||||||||| ||||| |||||||||||||||| |||| Sbjct: 18621 tccctgggttaggaagatcccctggagaagggcatggcaacccactccagtattcttgcc 18562 Query: 407 tagagaataccacggacag 425 | |||||| ||| |||||| Sbjct: 18561 tggagaatcccagggacag 18543 Score = 83.8 bits (42), Expect = 9e-14 Identities = 87/102 (85%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||| |||||| |||||||||||||||| ||| Sbjct: 26399 tccctgggtcaggaagatcccctggagaaggaaatggcaacccactccagtattcttgct 26340 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtcc 448 | | ||| ||| |||||| ||||||||| ||||||| |||| Sbjct: 26339 tgggaaatcccatggacagaggagcctggtgggctaccgtcc 26298 Score = 81.8 bits (41), Expect = 4e-13 Identities = 83/97 (85%) Strand = Plus / Plus Query: 357 gggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatac 416 |||||||||||| |||||| || ||||| ||||||||| |||||| ||||| |||||| | Sbjct: 43339 gggaagatcccctggagaaaggcatggcaacccactccggtattcttgcctggagaatcc 43398 Query: 417 cacggacaggggagcctggcgggctacagtccctagg 453 || | |||| |||| |||| |||||||||||| |||| Sbjct: 43399 catgaacagaggagtctggtgggctacagtccatagg 43435 Score = 79.8 bits (40), Expect = 1e-12 Identities = 100/118 (84%), Gaps = 4/118 (3%) Strand = Plus / Plus Query: 352 gggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctagag 411 |||| |||||||||||| |||| |||| ||||| |||||||||||||||| ||||||||| Sbjct: 93851 gggttgggaagatcccctggaggagggcatggcaacccactccagtattcttgcctagag 93910 Query: 412 aat-accacggacaggggagcct---ggcgggctacagtccctagggttgaaaagagt 465 ||| ||| |||||| |||||| || |||||||||||| | |||||| ||||||| Sbjct: 93911 aatccccatggacagaagagcctgtgggtgggctacagtccatggggttgcaaagagt 93968 Score = 75.8 bits (38), Expect = 2e-11 Identities = 62/70 (88%) Strand = Plus / Minus Query: 372 agaagggaatggctacccactccagtattcatgcctagagaataccacggacaggggagc 431 |||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||||| Sbjct: 69280 agaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacaggggagc 69221 Query: 432 ctggcgggct 441 ||||| |||| Sbjct: 69220 ctggcaggct 69211 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 59916 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 59857 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 59856 gcctggtgggct 59845 Score = 71.9 bits (36), Expect = 4e-10 Identities = 90/108 (83%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 |||||||| || |||| ||| |||||| |||||||||||||||| |||| | ||| || Sbjct: 6160 ggaagatctcctggaggaggaaatggcaacccactccagtattcttgccagggaaatccc 6219 Query: 418 acggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||| | |||||||||| ||||||||||| | |||||| ||||||| Sbjct: 6220 atggactgaggagcctggcaggctacagtccgtggggttgcaaagagt 6267 Score = 71.9 bits (36), Expect = 4e-10 Identities = 70/80 (87%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcat-gcctagagaataccacggacagggg 428 |||||||| |||||| ||||||| |||||||| | |||| |||||| ||| |||||| || Sbjct: 30673 ggagaaggaaatggcaacccacttcagtattctttgcctggagaatcccatggacagagg 30614 Query: 429 agcctggcgggctacagtcc 448 ||||||| |||||||||||| Sbjct: 30613 agcctggtgggctacagtcc 30594 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 70913 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 70972 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 70973 gcctggtgggct 70984 Score = 69.9 bits (35), Expect = 1e-09 Identities = 108/131 (82%), Gaps = 1/131 (0%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccgga-gaagggaatggctacccactccagtattcatgc 405 ||||||||| ||||||| |||| || ||||| ||||| |||||||||||||||| ||| Sbjct: 61358 tccctgggtcaggaagattcccctgaagaaggaaatggaaacccactccagtattcctgc 61299 Query: 406 ctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 || | ||| ||| ||||| ||||||||||||||| |||| | | |||||| ||||||| Sbjct: 61298 ctgggaaatcccatagacagaggagcctggcgggctgcagttcatggggttgcaaagagt 61239 Query: 466 tggatacaact 476 ||| |||||| Sbjct: 61238 cggacacaact 61228 Score = 69.9 bits (35), Expect = 1e-09 Identities = 59/67 (88%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| |||||| ||| Sbjct: 71813 ggagaaggaaatggcaacccactccagtattcttgcctggagaatcccatggacagagga 71754 Query: 430 gcctggc 436 | ||||| Sbjct: 71753 gtctggc 71747 Score = 69.9 bits (35), Expect = 1e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 362 gatcccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgg 421 ||||||| ||||||| ||| ||| |||||||||||||||| ||||| || ||| ||| || Sbjct: 82718 gatcccctggagaagagaaaggcaacccactccagtattcttgcctggaaaatgccatgg 82777 Query: 422 acaggggagcctggcgggctacagtcc 448 |||| ||||||||| || ||| ||||| Sbjct: 82778 acagaggagcctggtggactatagtcc 82804 Score = 67.9 bits (34), Expect = 6e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 40939 ggagaaggaaatggcaacccactccagtgttcttgccttgagaatcccagggaccgggga 40880 Query: 430 gcctgg 435 |||||| Sbjct: 40879 gcctgg 40874 Score = 65.9 bits (33), Expect = 2e-08 Identities = 45/49 (91%) Strand = Plus / Plus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 |||||||||| |||||||| |||||| |||||||||||||||| ||||| Sbjct: 9637 gaagatcccctggagaaggaaatggcaacccactccagtattcttgcct 9685 Score = 61.9 bits (31), Expect = 3e-07 Identities = 61/71 (85%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 ||||||| ||||||||||||| |||||||||| ||||| |||||| ||| ||| || ||| Sbjct: 80725 ggagaagagaatggctacccattccagtattcttgcctggagaatcccatggatagagga 80784 Query: 430 gcctggcgggc 440 | |||| |||| Sbjct: 80785 gtctggtgggc 80795 >gb|CM000188| Bos taurus chromosome 12-FRAG[5040000,5139999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 169/194 (87%), Gaps = 1/194 (0%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| ||||| ||| | ||||||||| |||||||| Sbjct: 32962 tggtaaagaatctgcctgcaatgcaggagacccgagtttaatccctgggttaggaagatc 32903 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacag 425 ||| ||||||| ||||||||||||||||||||||| ||||| | |||| ||| ||| || Sbjct: 32902 ccctagagaaggaaatggctacccactccagtattcttgcctggggaatcccatggatag 32843 Query: 426 gggagcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgact 485 |||||||||||||||||||||| |||||||| ||||||||||| | |||| || |||| Sbjct: 32842 aggagcctggcgggctacagtccatagggttgcaaagagttggacatgactg-agtgact 32784 Query: 486 cacactttcacttt 499 ||||||||||||| Sbjct: 32783 aacactttcacttt 32770 Score = 109 bits (55), Expect = 2e-21 Identities = 118/139 (84%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||||||||||||||| ||| || | ||||| ||||||||| |||||||||| | Sbjct: 55980 aaagaatctgcctgcaatgcaggagacatgagttcaatccctgggttgggaagatcctct 55921 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||||||||| ||||||||| || ||| | ||| |||||| ||| ||||| ||| Sbjct: 55920 agagaagggaatggcaacccactcccgtgttcttacctggagaattccatagacagagga 55861 Query: 430 gcctggcgggctacagtcc 448 |||||| |||||||||||| Sbjct: 55860 gcctggtgggctacagtcc 55842 Score = 95.6 bits (48), Expect = 2e-17 Identities = 117/140 (83%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| | ||||||| |||||||||||| |||| |||| ||||| |||||||||||||| Sbjct: 88220 ggttcaattcctgggtcgggaagatcccctggaggagggcatggcaacccactccagtat 88279 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaa 459 || || || |||||| ||| | |||| ||||||||| |||||| ||||| ||| |||| | Sbjct: 88280 tcttggctggagaatcccatgaacagaggagcctggtgggctagagtccatagagttgca 88339 Query: 460 aagagttggatacaactgaa 479 || |||| || || |||||| Sbjct: 88340 aaaagttagacacgactgaa 88359 Score = 87.7 bits (44), Expect = 6e-15 Identities = 110/132 (83%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||| ||| |||||||||||| ||| || | | ||| ||||||||| |||||||| Sbjct: 58296 atggtaaggaaactgcctgcaatgtaggagactcaagctcaatccctgggtcgggaagat 58237 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| | |||||| |||||| ||||||||||||||| ||| | |||||| ||| ||||| Sbjct: 58236 cccctgaagaaggtaatggcaacccactccagtatttttgcttggagaatcccatggaca 58177 Query: 425 ggggagcctggc 436 | |||||||||| Sbjct: 58176 gaggagcctggc 58165 Score = 85.7 bits (43), Expect = 2e-14 Identities = 70/79 (88%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||||||||||||||||||| |||||| |||| ||| | |||||||||||||| ||| Sbjct: 9117 tccctgggtggggaagatcccctggagaaaggaaaggccagccactccagtattctggcc 9176 Query: 407 tagagaataccacggacag 425 |||||||| ||| |||||| Sbjct: 9177 tagagaattccatggacag 9195 Score = 83.8 bits (42), Expect = 9e-14 Identities = 100/118 (84%), Gaps = 1/118 (0%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||| || | | ||| ||||||| | |||| || |||||||| Sbjct: 76006 atggtaaagaatctgcctgcagtgtggtagacctgggttcaatacctgagttgggaagat 75947 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacgga 422 ||| ||||||||||||||||||||| |||||||||| ||| |||||| ||||||| Sbjct: 75946 ccct-ggagaagggaatggctacccagtccagtattctgacctggagaattccacgga 75890 Score = 75.8 bits (38), Expect = 2e-11 Identities = 59/66 (89%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 18412 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccaaggacagggga 18471 Query: 430 gcctgg 435 |||||| Sbjct: 18472 gcctgg 18477 Score = 73.8 bits (37), Expect = 9e-11 Identities = 88/105 (83%) Strand = Plus / Plus Query: 319 gcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccccggagaaggg 378 |||| |||||| |||||||| ||||| | ||||||| |||||||||||| ||||||||| Sbjct: 75386 gcctccaatgcaggaaaccctggttcgattcctgggttgggaagatcccctggagaaggg 75445 Query: 379 aatggctacccactccagtattcatgcctagagaataccacggac 423 || | ||||||||| | |||||| |||| |||||| ||| |||| Sbjct: 75446 aaagtctacccacttctgtattctggcctggagaattccatggac 75490 Score = 71.9 bits (36), Expect = 4e-10 Identities = 144/178 (80%), Gaps = 4/178 (2%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||| |||| |||||||||| ||| ||| ||||| | | ||||||| |||||||| Sbjct: 78458 atggtaaataatccgcctgcaatgagggagacctgggttaaattcctgggttgggaagat 78517 Query: 365 cccccggagaagggaatg---gctacccactccagtattcatgcctagagaatacc-acg 420 ||| |||| ||| | | || |||||||||||||||| ||||| |||||| || | | Sbjct: 78518 cccttggaggaggtagggcatgcaacccactccagtattcttgcctggagaatccccatg 78577 Query: 421 gacaggggagcctggcgggctacagtccctagggttgaaaagagttggatacaactga 478 || || ||||||||| |||||||||||| | |||| ||||||||||| |||||||| Sbjct: 78578 gatagaggagcctggggggctacagtccatggggtcacaaagagttggacacaactga 78635 Score = 69.9 bits (35), Expect = 1e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 386 acccactccagtattcatgcctagagaataccacggacaggggagcctggcgggctacag 445 ||||||||||||| | ||||| |||||| ||| |||||| ||||||||||||||||||| Sbjct: 67281 acccactccagtaaccttgcctggagaattccatggacagaggagcctggcgggctacag 67222 Query: 446 tcc 448 ||| Sbjct: 67221 tcc 67219 Score = 67.9 bits (34), Expect = 6e-09 Identities = 108/130 (83%), Gaps = 2/130 (1%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| || ||||| || ||| ||| |||||| ||| Sbjct: 46500 ggagaaggcaatggcaccccactccagtactcttgcctggaaaatcccatggacagagga 46441 Query: 430 gcctggcgggctacagtccctagggttgaaaagagttggatacaactgaagcgactcaca 489 |||||| |||| |||||| | |||||| |||||| ||| ||||||| ||||||| || Sbjct: 46440 gcctggtaggctgcagtccatggggttgctaagagtcggacacaactg-agcgact-tca 46383 Query: 490 ctttcacttt 499 |||||||||| Sbjct: 46382 ctttcacttt 46373 Score = 65.9 bits (33), Expect = 2e-08 Identities = 81/97 (83%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| ||| | || || ||| | | ||| || Sbjct: 69707 atggtaaagaatctgcctgcaatgcaggagacctgttttggatctctgtgctgagaaaat 69766 Query: 365 cccccggagaagggaatggctacccactccagtattc 401 |||| |||| ||||||||||||||||||||||||||| Sbjct: 69767 cccctggaggagggaatggctacccactccagtattc 69803 Score = 65.9 bits (33), Expect = 2e-08 Identities = 54/61 (88%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| | ||||||| |||||||||||| |||||| ||| |||||||||||||||||| Sbjct: 69623 ggttcaattcctgggttgggaagatcccctggagaatggataggctacccactccagtat 69682 Query: 400 t 400 | Sbjct: 69683 t 69683 Score = 65.9 bits (33), Expect = 2e-08 Identities = 83/97 (85%), Gaps = 2/97 (2%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||| ||||| ||| | | |||| | ||||||||| ||||||| Sbjct: 75093 tggtaaagaatctgcctgccaatgcaggagatgcaggttga-tccctgggtcaggaagat 75035 Query: 365 cccccggagaagggaatggctacccactccagtattc 401 |||| ||||||| |||||| |||||||||||||||| Sbjct: 75034 cccctagagaaggaaatggcaacccactccagtattc 74998 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| || | ||||| Sbjct: 31396 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggcctgggga 31455 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 31456 gcctggtgggct 31467 Score = 63.9 bits (32), Expect = 9e-08 Identities = 59/68 (86%) Strand = Plus / Minus Query: 379 aatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggcgg 438 |||| ||| |||||||||||||| ||||| |||||| || |||||| ||||||||| || Sbjct: 35283 aatgactaaccactccagtattcttgcctggagaattacatggacagaggagcctggtgg 35224 Query: 439 gctacagt 446 |||||||| Sbjct: 35223 gctacagt 35216 Score = 58.0 bits (29), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||| ||||| ||| ||| || || ||||||||| |||||||||||| Sbjct: 26334 taaagaatctgcctgtaatgcaggagaccaggttttgatccctgggttgggaagatcccc 26393 Query: 369 cggagaagggaatggctacccactccagtattc 401 |||||| || |||| |||||||||||||| Sbjct: 26394 tggagaacacaagagctaaccactccagtattc 26426 >gb|CM000187| Bos taurus chromosome 11-FRAG[62640000,62739999] Length = 100000 Score = 178 bits (90), Expect = 2e-42 Identities = 144/162 (88%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||| |||||||||||||||| ||| ||| ||||||| ||||||||| ||||| || || Sbjct: 60009 gtaaacaatctgcctgcaatgcaggagacctgggttcaatccctgggttgggaatattcc 59950 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggacaggg 427 | ||||||||||||||| |||||||||||||||| ||||| |||||| |||||||||| | Sbjct: 59949 ctggagaagggaatggcaacccactccagtattcttgcctggagaatcccacggacagag 59890 Query: 428 gagcctggcgggctacagtccctagggttgaaaagagttgga 469 |||||||| |||||||||||| | |||||| ||||||||||| Sbjct: 59889 gagcctggtgggctacagtccatggggttgtaaagagttgga 59848 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||| | |||||||||||| |||||||| |||||| |||||||||||||||| ||| Sbjct: 56374 tccctggtttgggaagatcccctggagaaggaaatggcaacccactccagtattctagcc 56433 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||||| ||| ||| || |||||||||| ||||||||||| |||||||||| ||||| Sbjct: 56434 tggagaatcccatggatagaggagcctggcaggctacagtccatagggttgaacagagt 56492 Score = 113 bits (57), Expect = 1e-22 Identities = 135/161 (83%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| | | ||||| ||||||||| ||| || Sbjct: 30663 atggtaaagaatctgcctgcaatgcaggagaactgggttagatccctgggtcaggacaat 30604 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||||||||||||||| || |||||||||||| ||||| |||||| ||| ||||| Sbjct: 30603 cccctggagaagggaatggctgcctactccagtattcctgcctggagaattccatggaca 30544 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | |||| |||||| |||| ||||| | || ||| ||||||| Sbjct: 30543 gaggagtctggcgagctatagtccatgggattgcaaagagt 30503 Score = 111 bits (56), Expect = 4e-22 Identities = 143/172 (83%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| |||||||| |||||| ||| |||| |||||| || |||||| |||||||| Sbjct: 35928 atggtaaagcatctgcctacaatgcaggagacccaggttcaatctctgggtcgggaagat 35987 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 || | |||||||| |||||| ||||||||||||| || ||||| || ||| ||| ||||| Sbjct: 35988 cctctggagaaggaaatggcaacccactccagtagtcttgcctggaaaatcccatggaca 36047 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttggatacaact 476 | ||||| | ||||||||||| | |||||| ||||||| ||| |||||| Sbjct: 36048 gaggagcgtcataggctacagtccatggggttgcaaagagtcggacacaact 36099 Score = 99.6 bits (50), Expect = 2e-18 Identities = 110/130 (84%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||| |||||||||||| || ||| ||| ||||| ||||||||| |||||||| Sbjct: 93032 atggtaaaaaatctgcctgcagtgggggagacctgggtttgatccctgggttgggaagat 93091 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 ||| |||||||||||| | |||||||||||||||| |||||||||||| ||| || || Sbjct: 93092 gccctggagaagggaatatccacccactccagtattcttgcctagagaattccatgggca 93151 Query: 425 ggggagcctg 434 | |||||||| Sbjct: 93152 gaggagcctg 93161 Score = 97.6 bits (49), Expect = 6e-18 Identities = 159/193 (82%), Gaps = 2/193 (1%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 |||||||||||||| |||||||||| |||||| | ||| ||||||||| |||||||| Sbjct: 1456 atggtaaagaatctacctgcaatgcaagaaacctgtgtttgatccctgggttgggaagat 1397 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| | ||||| |||||||||| ||||||||||| ||||| |||||| ||| ||||| Sbjct: 1396 cccctgaagaagcaaatggctacctcctccagtattcttgcctggagaattccatggaca 1337 Query: 425 ggggagcctggcgggctacagtccctaggg-ttgaaaagagttggatacaactgaagcga 483 |||| ||| |||||||||||| | ||| ||| ||||||| || ||||||| || || Sbjct: 1336 acagagcttggtgggctacagtccatggggtttgcaaagagtctgacacaactg-agtga 1278 Query: 484 ctcacactttcac 496 || |||||||||| Sbjct: 1277 ctaacactttcac 1265 Score = 91.7 bits (46), Expect = 4e-16 Identities = 118/142 (83%) Strand = Plus / Plus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| ||||||||| |||||||| ||| |||| |||| ||||| |||||||||||| || Sbjct: 97626 gttcattccctgggttgggaagataccctggaggagggcatggcaacccactccagtgtt 97685 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaa 460 | ||||| |||||| ||| | |||| ||| ||||| |||||| ||||| |||||| || Sbjct: 97686 cgtgcctggagaatcccatgcacagaggaacctggtgggctatagtccatagggtcacaa 97745 Query: 461 agagttggatacaactgaagcg 482 ||||| || |||||||||||| Sbjct: 97746 agagtcagacacaactgaagcg 97767 Score = 79.8 bits (40), Expect = 1e-12 Identities = 115/140 (82%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 |||||||||||||| || || ||| |||| |||||| | | || || | || ||||||| Sbjct: 25667 taaagaatctgcctacattgtgggagacccaggttcaattcttgagttgagaggatcccc 25726 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 ||| |||| ||||| |||||||||||||||| ||||| || ||| ||| |||||| || Sbjct: 25727 tagaggagggtatggcaacccactccagtattcttgcctggaaaatgccatggacagagg 25786 Query: 429 agcctggcgggctacagtcc 448 |||||||| ||||||||||| Sbjct: 25787 agcctggcaggctacagtcc 25806 Score = 79.8 bits (40), Expect = 1e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 355 tggggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||| ||||| |||||||||||| || ||||||||||||| || || | |||||| Sbjct: 14161 tggggaaggtcccctggagaagggaatagcaacccactccagtactcttgtgtggagaat 14102 Query: 415 accacggacaggggagcctggcgggctacagt 446 ||| |||||| |||||||||| ||||||||| Sbjct: 14101 cccatggacagaggagcctggcaggctacagt 14070 Score = 75.8 bits (38), Expect = 2e-11 Identities = 78/90 (86%), Gaps = 1/90 (1%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||| || ||| ||| ||||||| ||||||||| | |||||| Sbjct: 86484 tggtaaagaatccacctgcaacgcaggagacctgggttcaatccctgggttgtgaagat- 86426 Query: 366 ccccggagaagggaatggctacccactcca 395 ||||||||||||||| |||||| ||||||| Sbjct: 86425 ccccggagaagggaaaggctacgcactcca 86396 Score = 75.8 bits (38), Expect = 2e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||| | ||||||||||| |||| |||| || ||| ||||||||| Sbjct: 84849 gggttcaatccctggatcaggaagatcccctggaggagggctcggggaccgactccagta 84908 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||| |||| ||||||| ||| |||||| |||||| ||||||||||||||| Sbjct: 84909 ttcttgcccagagaatcccagggacagaggagcccggcgggctacagtcc 84958 Score = 71.9 bits (36), Expect = 4e-10 Identities = 60/68 (88%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| ||||||||||| |||||||||||||| ||||||||| ||||||| || | Sbjct: 36968 tccctgggtcaggaagatcccctggagaagggaatggttacccactctagtattcttgtc 36909 Query: 407 tagagaat 414 | |||||| Sbjct: 36908 tggagaat 36901 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 45848 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 45789 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 45788 gcctggtgggct 45777 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 3606 ggagaaggcaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 3547 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 3546 gcctggtgggct 3535 Score = 71.9 bits (36), Expect = 4e-10 Identities = 63/72 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 70213 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggggga 70154 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 70153 gcctggtgggct 70142 Score = 71.9 bits (36), Expect = 4e-10 Identities = 96/116 (82%) Strand = Plus / Plus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 |||||||||||| || | |||| ||| ||| ||||| ||||||| | || | |||||| Sbjct: 23214 gtaaagaatctgactcctatgcaggagacctgggtttgatccctggtttggaaggatccc 23273 Query: 368 ccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 | ||||||||||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 23274 ctggagaagggaaaggctacccactccagtattctggcctggagaattccatggac 23329 Score = 71.9 bits (36), Expect = 4e-10 Identities = 82/96 (85%), Gaps = 1/96 (1%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| || ||||||||| |||| |||| || || ||| |||||||||||| |||| Sbjct: 5558 tccctgggttggcaagatcccctggaggagggcatagcaacctactccagtattcttgcc 5617 Query: 407 tagagaat-accacggacaggggagcctggcgggct 441 |||||||| ||| |||||| |||||||||| |||| Sbjct: 5618 tagagaatccccatggacagaggagcctggcaggct 5653 Score = 63.9 bits (32), Expect = 9e-08 Identities = 63/72 (87%), Gaps = 1/72 (1%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 72170 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggac-gggga 72228 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 72229 gcctggtgggct 72240 Score = 63.9 bits (32), Expect = 9e-08 Identities = 65/76 (85%) Strand = Plus / Minus Query: 359 gaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacca 418 |||||||||| |||||||| ||| || |||||||||||||||| ||||| || ||| ||| Sbjct: 33174 gaagatcccctggagaaggaaatcgcaacccactccagtattcttgcctggaaaatccca 33115 Query: 419 cggacaggggagcctg 434 |||||| ||| |||| Sbjct: 33114 gggacagaggatcctg 33099 Score = 63.9 bits (32), Expect = 9e-08 Identities = 80/96 (83%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||| |||| ||||| ||| |||||||||||| ||||| || ||| ||| |||||| ||| Sbjct: 21345 ggaggagggtatggcaacctactccagtattcttgcctggaaaattccatggacagagga 21286 Query: 430 gcctggcgggctacagtccctagggttgaaaagagt 465 |||||| || ||| ||||| | |||||| ||||||| Sbjct: 21285 gcctggtggactatagtccatggggttgcaaagagt 21250 Score = 61.9 bits (31), Expect = 3e-07 Identities = 76/91 (83%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| ||| |||| |||| | |||||| ||||||| ||||||| ||| | Sbjct: 46140 ggaagatcccctagaggagggcatggtaatccactctagtattcttgcctaggaaattct 46199 Query: 418 acggacaggggagcctggcgggctacagtcc 448 | |||||| |||||||||||||||||||||| Sbjct: 46200 atggacagaggagcctggcgggctacagtcc 46230 Score = 61.9 bits (31), Expect = 3e-07 Identities = 52/59 (88%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcct 407 ||||||| |||||||| ||| |||||||| |||||| ||||||||||||| || ||||| Sbjct: 87258 cctgggttgggaagattccctggagaaggaaatggcaacccactccagtactcttgcct 87316 Score = 61.9 bits (31), Expect = 3e-07 Identities = 61/71 (85%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| |||| Sbjct: 63152 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacgtggga 63211 Query: 430 gcctggcgggc 440 |||||| |||| Sbjct: 63212 gcctggtgggc 63222 Score = 60.0 bits (30), Expect = 1e-06 Identities = 105/130 (80%) Strand = Plus / Minus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 |||||| || |||||||||||| |||| |||| ||||| || | |||||||| | ||| Sbjct: 74966 tccctgtgtcgggaagatcccctggaggagggcatggcacccgattccagtatccttgct 74907 Query: 407 tagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagtt 466 |||| ||| ||| ||||| ||||||||||||||| ||||| | |||| |||||||| Sbjct: 74906 tagaaaattccatggacacaggagcctggcgggctgcagtcgatggggtcacaaagagtt 74847 Query: 467 ggatacaact 476 ||| |||||| Sbjct: 74846 ggacacaact 74837 Score = 58.0 bits (29), Expect = 5e-06 Identities = 56/65 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||| | ||| Sbjct: 34823 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacggagga 34882 Query: 430 gcctg 434 ||||| Sbjct: 34883 gcctg 34887 >gi|112110930|gb|AAFC03067381.1| Bos taurus Ctg68.CH240-451L4, whole genome shotgun sequence, ChrUn.003.3715 Length = 18853 Score = 176 bits (89), Expect = 8e-42 Identities = 143/161 (88%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||||||||||||||||| ||| |||||||||| |||||||||| |||||||| Sbjct: 944 atggtaaagaatctgcctgcaatgcaggagacccgggttcggtccctgggtcgggaagat 885 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| |||||||||||||||| ||||| ||||||||| ||||| Sbjct: 884 cccctggagaagggaatggcaacccactccagtattcttgcctgaagaataccatggaca 825 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagt 465 | ||||||| |||||| ||||| | |||||| ||||||| Sbjct: 824 gaggagcctcctgggctatagtccatggggttgcaaagagt 784 Score = 89.7 bits (45), Expect = 2e-15 Identities = 69/77 (89%) Strand = Plus / Plus Query: 347 tccctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcc 406 ||||||||| |||||||||||| ||||||||||| ||||||||| |||||||||| ||| Sbjct: 1343 tccctgggttgggaagatcccctggagaagggaaaggctacccagtccagtattctggcc 1402 Query: 407 tagagaataccacggac 423 | |||||| |||||||| Sbjct: 1403 tggagaattccacggac 1419 >gb|CH974535| Bos taurus ChrUn.003.332 genomic scaffold Length = 277902 Score = 176 bits (89), Expect = 8e-42 Identities = 146/165 (88%) Strand = Plus / Plus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||||| ||||||||||||| || ||||||||||| |||||||||||| ||||| Sbjct: 252375 atggtaaagaaactgcctgcaatgcaggcaacccgggttcgatccctgggtgggaaagat 252434 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| ||||||||||||||| ||||| |||||||||| ||||| |||||| ||| ||||| Sbjct: 252435 cccctggagaagggaatggcaacccattccagtattcttgcctggagaattccatggaca 252494 Query: 425 ggggagcctggcgggctacagtccctagggttgaaaagagttgga 469 | |||||||||||||||||||||| | |||| ||||||||||| Sbjct: 252495 gaggagcctggcgggctacagtccatggggtcacaaagagttgga 252539 Score = 109 bits (55), Expect = 2e-21 Identities = 123/143 (86%), Gaps = 2/143 (1%) Strand = Plus / Plus Query: 307 ggtaaagaatctgcctgc-aatgctggaaacccgggttcagtccctgggt-ggggaagat 364 |||||||||||||||||| ||||| || || ||||||| || |||||| ||||||||| Sbjct: 10617 ggtaaagaatctgcctgccaatgcaagagacttgggttcaatctctgggttggggaagat 10676 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 |||| |||| ||| |||||| || ||||||||||||| ||||| |||||| ||| ||||| Sbjct: 10677 cccctggaggaggaaatggcaactcactccagtattcttgcctggagaattccatggaca 10736 Query: 425 ggggagcctggcgggctacagtc 447 | |||||||||| |||||||||| Sbjct: 10737 gaggagcctggcaggctacagtc 10759 Score = 107 bits (54), Expect = 6e-21 Identities = 111/130 (85%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| ||||||||||| |||||||| |||||| ||||||||||||| || ||||| Sbjct: 167428 cctgggtcaggaagatcccctggagaaggaaatggcaacccactccagtactcttgcctg 167369 Query: 409 gagaataccacggacaggggagcctggcgggctacagtccctagggttgaaaagagttgg 468 |||||| ||| |||||| ||||||||| ||||||||||| | |||| | |||||||||| Sbjct: 167368 gagaatcccagggacagaggagcctggtaggctacagtccatggggtcgcaaagagttgg 167309 Query: 469 atacaactga 478 | || ||||| Sbjct: 167308 acaccactga 167299 Score = 103 bits (52), Expect = 1e-19 Identities = 121/144 (84%) Strand = Plus / Minus Query: 305 atggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagat 364 ||||||||| |||||||| |||||| ||| ||| ||||||||||||||||| ||||||| Sbjct: 228712 atggtaaagcatctgcctacaatgcaggagacctgggttcagtccctgggtcaggaagat 228653 Query: 365 cccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggaca 424 | || | |||||| |||||| |||||||||||||||| || || | || ||| ||||| Sbjct: 228652 ctcctgaagaaggaaatggcaacccactccagtattcttgtctgaaaaaccccatggaca 228593 Query: 425 ggggagcctggcgggctacagtcc 448 | ||||||||| ||||||||||| Sbjct: 228592 gaggagcctggtaggctacagtcc 228569 Score = 99.6 bits (50), Expect = 2e-18 Identities = 92/106 (86%) Strand = Plus / Plus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||||||||||||||| || ||| ||| |||||| ||||||||| |||||||||| | Sbjct: 52842 taaagaatctgcctgcagtgtgggagacctgggttcgatccctgggttgggaagatcctc 52901 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaat 414 ||||||||||| |||||||||||||||||||| |||| |||||| Sbjct: 52902 tggagaagggaacggctacccactccagtattctggcctggagaat 52947 Score = 95.6 bits (48), Expect = 2e-17 Identities = 99/116 (85%) Strand = Plus / Minus Query: 333 aaacccgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccact 392 |||||| | |||| ||||| ||| |||||||||||| |||||||| |||||| | ||||| Sbjct: 210639 aaacccagtttcaatcccttggttgggaagatcccctggagaaggaaatggcaatccact 210580 Query: 393 ccagtattcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 ||||||||| ||||| |||||| ||| |||||| |||||||| || ||||||||| Sbjct: 210579 ccagtattcctgcctggagaattccatggacagaggagcctgatggactacagtcc 210524 Score = 93.7 bits (47), Expect = 1e-16 Identities = 95/111 (85%) Strand = Plus / Plus Query: 338 cgggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagt 397 |||||| | ||||||||| |||||||||||| |||| ||| |||||| |||||||||| | Sbjct: 7595 cgggtttattccctgggttgggaagatcccctggaggaggaaatggcaacccactccaat 7654 Query: 398 attcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 |||| ||||| |||| | ||| |||||| | ||| |||||||||||||||| Sbjct: 7655 attcttgcctggagactcccatggacagagaagcttggcgggctacagtcc 7705 Score = 93.7 bits (47), Expect = 1e-16 Identities = 107/127 (84%) Strand = Plus / Plus Query: 339 gggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagta 398 ||||||| ||||||||| ||||||||| || |||||||| |||||| ||||||||||||| Sbjct: 184393 gggttcaatccctgggttgggaagatctcctggagaaggaaatggcaacccactccagta 184452 Query: 399 ttcatgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttga 458 ||| ||||| || ||| ||| |||||| | ||||||| | ||||||||| | | |||| Sbjct: 184453 ttcttgcctggaaaatcccatggacagagaagcctggtagactacagtccgtggtgttgc 184512 Query: 459 aaagagt 465 ||||||| Sbjct: 184513 aaagagt 184519 Score = 91.7 bits (46), Expect = 4e-16 Identities = 101/118 (85%), Gaps = 1/118 (0%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 |||||| ||||||||||||| ||| ||||| |||||||||||||||||||| ||||| Sbjct: 147303 cctgggcggggaagatcccctagaggagggataggctacccactccagtattcttgcctg 147244 Query: 409 gagaat-accacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 |||||| ||| |||||| ||| |||||| ||||||||||| | |||||| ||||||| Sbjct: 147243 gagaatccccatggacagaggaacctggcaggctacagtccatggggttgcaaagagt 147186 Score = 91.7 bits (46), Expect = 4e-16 Identities = 101/118 (85%), Gaps = 1/118 (0%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 |||||| ||||||||||||| ||| ||||| |||||||||||||||||||| ||||| Sbjct: 54264 cctgggcggggaagatcccctagaggagggataggctacccactccagtattcttgcctg 54205 Query: 409 gagaat-accacggacaggggagcctggcgggctacagtccctagggttgaaaagagt 465 |||||| ||| |||||| ||| |||||| ||||||||||| | |||||| ||||||| Sbjct: 54204 gagaatccccatggacagaggaacctggcaggctacagtccatggggttgcaaagagt 54147 Score = 91.7 bits (46), Expect = 4e-16 Identities = 82/94 (87%) Strand = Plus / Minus Query: 308 gtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccc 367 ||||||||||||||| || ||| ||| |||| |||||| ||||||||| |||||||| | Sbjct: 212316 gtaaagaatctgcctacagtgcaggagacccaggttcaatccctgggtcaggaagatctc 212257 Query: 368 ccggagaagggaatggctacccactccagtattc 401 | |||||||| |||||| |||||||||||||||| Sbjct: 212256 ctggagaaggaaatggcaacccactccagtattc 212223 Score = 91.7 bits (46), Expect = 4e-16 Identities = 97/114 (85%) Strand = Plus / Minus Query: 310 aaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatccccc 369 |||||||| |||||||||| ||| ||| |||||| ||||||||| |||||||||||| Sbjct: 201193 aaagaatccgcctgcaatgtgggagacctgggttcgatccctgggttgggaagatcccct 201134 Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 |||||||| || ||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 201133 ggagaaggcaaaagctacccactccagtattctggcctggagaattccatggac 201080 Score = 91.7 bits (46), Expect = 4e-16 Identities = 100/118 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| ||||||||| ||| ||| |||| ||||||||| ||||||||| Sbjct: 199108 tggtaaagaatccacctgcaatgtgggagacctgggtgtgatccctgggttgggaagatc 199049 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| ||||||||||| |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 199048 ccctggagaagggaaaggctacccactccagtattctggcctggagaattccatggac 198991 Score = 87.7 bits (44), Expect = 6e-15 Identities = 116/140 (82%) Strand = Plus / Minus Query: 309 taaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcccc 368 ||||| ||||||||| ||||| ||| |||| ||||| ||||||||| |||||| ||||| Sbjct: 155369 taaagcatctgcctggaatgcgggagacccaggttcgatccctgggtcgggaaggtcccc 155310 Query: 369 cggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggg 428 |||||||| |||||| ||||||||||||| || || || |||||| ||| | | | || Sbjct: 155309 tggagaaggaaatggcaacccactccagtactcttggctggagaatcccatgaaaggagg 155250 Query: 429 agcctggcgggctacagtcc 448 ||||||| ||||||||||| Sbjct: 155249 agcctggtaggctacagtcc 155230 Score = 83.8 bits (42), Expect = 9e-14 Identities = 99/118 (83%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| || |||||| ||||||||| |||||||| Sbjct: 31727 tggtaaagaatccgcctgcaatgtgggagactggggttcgatccctgggttgggaagatt 31668 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| |||||||||| ||||||||||||||||| || |||| |||||| ||| |||| Sbjct: 31667 ccctagagaagggaaaggctacccactccagtactctggcctggagaattccatggac 31610 Score = 83.8 bits (42), Expect = 9e-14 Identities = 114/138 (82%) Strand = Plus / Minus Query: 341 gttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtatt 400 ||||| |||||||| ||||||||||| |||||||| |||||| | ||||||||||||| Sbjct: 202411 gttcaatccctggggcaggaagatcccctggagaaggaaatggcaaaccactccagtatt 202352 Query: 401 catgcctagagaataccacggacaggggagcctggcgggctacagtccctagggttgaaa 460 | ||||| |||||| ||| || || ||||||||| ||||||||| | | |||| || Sbjct: 202351 cttgcctggagaatcccatagatagaagagcctggcaggctacagttcatgcagttgcaa 202292 Query: 461 agagttggatacaactga 478 ||||||||| |||||||| Sbjct: 202291 agagttggacacaactga 202274 Score = 81.8 bits (41), Expect = 4e-13 Identities = 77/89 (86%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| || | ||||| | ||||||| ||||||||| Sbjct: 165553 tggtaaagaatctgcctgcaatgcaggagactccagttcacttcctgggtcgggaagatc 165494 Query: 366 ccccggagaagggaatggctacccactcc 394 | | |||||||||| ||||||||||||| Sbjct: 165493 cgctggagaagggataggctacccactcc 165465 Score = 79.8 bits (40), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||| || |||||||||| ||| |||| |||| | ||||||| ||||||||| Sbjct: 31846 tggtaaagagtccacctgcaatgcaggagaccccagttcgattcctgggttgggaagatc 31787 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 ||| |||||||||| |||||||||||||||||||| Sbjct: 31786 ccctggagaagggataggctacccactccagtattc 31751 Score = 77.8 bits (39), Expect = 6e-12 Identities = 85/100 (85%), Gaps = 4/100 (4%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 ||||||||||||||||||||| | ||| ||| || |||| ||||||||| ||||||||| Sbjct: 165434 tggtaaagaatctgcctgcaaaacgggagacctggattcaatccctgggttgggaagatc 165375 Query: 366 ccccggagaagggaatggc----tacccactccagtattc 401 ||| |||||||||| ||| ||||||||||||||||| Sbjct: 165374 ccctggagaagggataggctacttacccactccagtattc 165335 Score = 77.8 bits (39), Expect = 6e-12 Identities = 87/103 (84%) Strand = Plus / Plus Query: 342 ttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtattc 401 |||| ||||||||| |||||||||||| | ||||||||||||| ||||| |||||||||| Sbjct: 276592 ttcaatccctgggttgggaagatcccctgcagaagggaatggcaacccaatccagtattc 276651 Query: 402 atgcctagagaataccacggacaggggagcctggcgggctaca 444 |||| || ||| ||| |||||| ||||| || |||||||| Sbjct: 276652 ttgccaggataatcccatggacagaggagctgggtgggctaca 276694 Score = 77.8 bits (39), Expect = 6e-12 Identities = 69/79 (87%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||||||| ||||| |||||| ||| | |||| | | Sbjct: 275899 ggagaaggaaatggcaacccactccagtattcttgcctggagaattccatgaacagagaa 275840 Query: 430 gcctggcgggctacagtcc 448 |||||| |||||||||||| Sbjct: 275839 gcctggtgggctacagtcc 275821 Score = 75.8 bits (38), Expect = 2e-11 Identities = 80/94 (85%) Strand = Plus / Minus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| ||| || | ||||| |||||||||||||||| ||||| Sbjct: 65974 cctgggtcgggaagatcccctagaggagtgcatggcaacccactccagtattcttgcctg 65915 Query: 409 gagaataccacggacaggggagcctggcgggcta 442 |||||| | | |||||| ||||||||| |||||| Sbjct: 65914 gagaatcctatggacagaggagcctggtgggcta 65881 Score = 75.8 bits (38), Expect = 2e-11 Identities = 80/94 (85%) Strand = Plus / Plus Query: 349 cctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgccta 408 ||||||| |||||||||||| ||| || | ||||| |||||||||||||||| ||||| Sbjct: 105505 cctgggtcgggaagatcccctagaggagtgcatggcaacccactccagtattcttgcctg 105564 Query: 409 gagaataccacggacaggggagcctggcgggcta 442 |||||| | | |||||| ||||||||| |||||| Sbjct: 105565 gagaatcctatggacagaggagcctggtgggcta 105598 Score = 75.8 bits (38), Expect = 2e-11 Identities = 86/102 (84%) Strand = Plus / Plus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||||||||||||||| ||| | | |||||| ||||||||| |||||||| Sbjct: 191838 tggtaaagaatctgcctgcaatgcaggagatgcaggttcaatccctgggtcaggaagatc 191897 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcct 407 | | |||||| | |||||| || |||||||||| || ||||| Sbjct: 191898 ctctggagaaagaaatggcaactcactccagtaatcttgcct 191939 Score = 73.8 bits (37), Expect = 9e-11 Identities = 58/65 (89%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| |||||||||| Sbjct: 271118 ggagaaggaaatggcaacccactccagtgttcttgcctggagaatcccagggacagggga 271177 Query: 430 gcctg 434 ||||| Sbjct: 271178 gcctg 271182 Score = 71.9 bits (36), Expect = 4e-10 Identities = 81/96 (84%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||||||||| |||||||||| ||| |||| |||||| | ||||||| |||||||| Sbjct: 201316 tggtaaagaatccacctgcaatgcaggagaccccggttcaattcctgggtcaggaagatc 201257 Query: 366 ccccggagaagggaatggctacccactccagtattc 401 | | | |||||||| ||||||| |||||||||||| Sbjct: 201256 cgctgcagaagggacaggctacctactccagtattc 201221 Score = 69.9 bits (35), Expect = 1e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 307 ggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatcc 366 ||||||||||| |||||||||| ||| ||| ||||| ||| ||||| |||||||| | Sbjct: 48223 ggtaaagaatccacctgcaatgcgggagacctgggtttgatccttgggttgggaagatac 48164 Query: 367 cccggagaagggaatggctacccactccagtattcatgcctagagaa 413 || |||| |||| ||||| ||||| |||||||||| ||||| ||||| Sbjct: 48163 cctggaggagggcatggcaacccattccagtattcttgcctggagaa 48117 Score = 67.9 bits (34), Expect = 6e-09 Identities = 67/78 (85%) Strand = Plus / Plus Query: 358 ggaagatcccccggagaagggaatggctacccactccagtattcatgcctagagaatacc 417 ||||||||||| |||| ||| |||||| |||||||||||||||| |||| || ||| || Sbjct: 163651 ggaagatcccctggaggaggaaatggcaacccactccagtattcttgccaggaaaattcc 163710 Query: 418 acggacaggggagcctgg 435 |||||||| | ||||||| Sbjct: 163711 acggacagagaagcctgg 163728 Score = 67.9 bits (34), Expect = 6e-09 Identities = 61/70 (87%) Strand = Plus / Plus Query: 350 ctgggtggggaagatcccccggagaagggaatggctacccactccagtattcatgcctag 409 |||||| |||||||||||| ||||||||||| ||||||||||| ||||||| |||| | Sbjct: 250801 ctgggttgggaagatcccctggagaagggaaaggctacccactgtagtattctggcctgg 250860 Query: 410 agaataccac 419 ||||| |||| Sbjct: 250861 agaattccac 250870 Score = 67.9 bits (34), Expect = 6e-09 Identities = 97/118 (82%) Strand = Plus / Minus Query: 306 tggtaaagaatctgcctgcaatgctggaaacccgggttcagtccctgggtggggaagatc 365 |||||| |||||||||| |||||| | | ||| |||| | || ||||| ||||||||| Sbjct: 117144 tggtaaggaatctgccttcaatgcagtagacctgggtccgatctctgggatgggaagatc 117085 Query: 366 ccccggagaagggaatggctacccactccagtattcatgcctagagaataccacggac 423 ||| |||||||| | |||||||||||||||||||| |||| |||||| ||| |||| Sbjct: 117084 ccctggagaaggacacggctacccactccagtattctggcctggagaattccatggac 117027 Score = 65.9 bits (33), Expect = 2e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 377 ggaatggctacccactccagtattcatgcctagagaataccacggacaggggagcctggc 436 |||||||| |||||||||||| ||| ||||| |||||| ||| |||| ||||||||||| Sbjct: 214593 ggaatggcaacccactccagtgttcttgcctggagaatcccagggacgggggagcctggt 214534 Query: 437 gggct 441 ||||| Sbjct: 214533 gggct 214529 Score = 65.9 bits (33), Expect = 2e-08 Identities = 42/45 (93%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaat 414 |||||||||||||||||||||||||||||||| ||| | |||||| Sbjct: 227522 ggagaagggaatggctacccactccagtattcttgcttggagaat 227566 Score = 65.9 bits (33), Expect = 2e-08 Identities = 90/109 (82%) Strand = Plus / Plus Query: 340 ggttcagtccctgggtggggaagatcccccggagaagggaatggctacccactccagtat 399 |||||| ||||||||| ||||||||||| |||| ||| |||||| || || || ||||| Sbjct: 141734 ggttcaatccctgggtcaggaagatcccctggaggaggaaatggcaactcattctagtat 141793 Query: 400 tcatgcctagagaataccacggacaggggagcctggcgggctacagtcc 448 || || || | || ||| ||||||||||||||||| ||||||||||| Sbjct: 141794 tcttgtctgggatatcccatggacaggggagcctggcaggctacagtcc 141842 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Plus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| ||||||||||| ||| ||||| |||||| ||| |||| ||||| Sbjct: 264700 ggagaaggaaatggcaacccactccagctttcttgcctggagaatcccagggacggggga 264759 Query: 430 gcctggcgggct 441 |||||| ||||| Sbjct: 264760 gcctggtgggct 264771 Score = 63.9 bits (32), Expect = 9e-08 Identities = 62/72 (86%) Strand = Plus / Minus Query: 370 ggagaagggaatggctacccactccagtattcatgcctagagaataccacggacagggga 429 |||||||| |||||| |||||||||||| ||| ||||| |||||| ||| ||| |